EMAIL THIS PAGE TO A FRIEND

SH3RF2

SH3 domain containing ring finger 2

Synonyms: HEPP1 POSHER PPP1R39 RNF158
UniProtKB ID: Q8TEC5, A8K961, Q08AM9, Q6GMR9, Q8N5S8, Q96LP8
Gene ID:
Mouse(269016) SH3 domain containing ring finger 2
Rat(307472) SH3 domain containing ring finger 2
chicken(416346) SH3 domain containing ring finger 2
domestic cat(101082800) SH3 domain containing ring finger 2
dog(478049) SH3 domain containing ring finger 2
Horse(100071998) SH3 domain containing ring finger 2
domestic guinea pig(100729949) SH3 domain containing ring finger 2
naked mole-rat(101696288) SH3 domain containing ring finger 2
sheep(101111630) SH3 domain containing ring finger 2
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152550 Rosetta Predictions human pricing
NM_001034187 Rosetta Predictions rat pricing
NM_172966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095854 predicted 2432
2 SASI_Hs02_00366357 predicted 646
3 SASI_Hs01_00095857 predicted 2393
4 SASI_Hs01_00095858 predicted 1724
5 SASI_Hs01_00095859 predicted 1507
6 SASI_Hs01_00095860 predicted 1595
7 SASI_Hs01_00095861 predicted 2384
8 SASI_Hs01_00095862 predicted 1137
9 SASI_Hs01_00095863 predicted 2107
10 SASI_Hs02_00366358 predicted 630
11 SASI_Hs01_00095855 predicted 1675
12 SASI_Hs01_00095856 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039749 predicted 1593
2 SASI_Rn01_00039750 predicted 1477
3 SASI_Rn01_00039751 predicted 895
4 SASI_Rn01_00039753 predicted 1180
5 SASI_Rn01_00039754 predicted 1952
6 SASI_Rn01_00039755 predicted 917
7 SASI_Rn01_00039756 predicted 743
8 SASI_Rn02_00204021 predicted 851
9 SASI_Rn01_00039757 predicted 1432
10 SASI_Rn01_00039758 predicted 1407
11 SASI_Rn01_00039752 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055613 predicted 2085
2 SASI_Mm01_00055614 predicted 1177
3 SASI_Mm01_00055615 predicted 1817
4 SASI_Mm01_00055616 predicted 2134
5 SASI_Mm01_00055617 predicted 1345
6 SASI_Mm01_00055618 predicted 2276
7 SASI_Mm01_00055619 predicted 2286
8 SASI_Mm01_00055620 predicted 2074
9 SASI_Mm01_00055621 predicted 1484
10 SASI_Mm01_00055622 predicted 1735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152550
SH3RF2 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing ring finger 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152550.3-1600s21c1
Sequence:CCGGCTACACCACATGGACGTTATCCTCGAGGATAACGTCCATGTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152550.3-2816s21c1
Sequence:CCGGTGCTTCTTTGACCTTACAATACTCGAGTATTGTAAGGTCAAAGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152550.3-874s21c1
Sequence:CCGGGACCTTCCTCAAGGACGATATCTCGAGATATCGTCCTTGAGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-916s1c1
Sequence:CCGGGAAGGCAAGTTAGGAGATAAACTCGAGTTTATCTCCTAACTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-924s1c1
Sequence:CCGGGTTAGGAGATAAAGTAGGCATCTCGAGATGCCTACTTTATCTCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-1512s1c1
Sequence:CCGGCTTCCCAAACAATTACGTCATCTCGAGATGACGTAATTGTTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-685s1c1
Sequence:CCGGCGGAGACAGCTTGATGAGAATCTCGAGATTCTCATCAAGCTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152550
SH3RF2 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing ring finger 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152550.3-1600s21c1
Sequence:CCGGCTACACCACATGGACGTTATCCTCGAGGATAACGTCCATGTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152550.3-2816s21c1
Sequence:CCGGTGCTTCTTTGACCTTACAATACTCGAGTATTGTAAGGTCAAAGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152550.3-874s21c1
Sequence:CCGGGACCTTCCTCAAGGACGATATCTCGAGATATCGTCCTTGAGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-916s1c1
Sequence:CCGGGAAGGCAAGTTAGGAGATAAACTCGAGTTTATCTCCTAACTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-924s1c1
Sequence:CCGGGTTAGGAGATAAAGTAGGCATCTCGAGATGCCTACTTTATCTCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-1512s1c1
Sequence:CCGGCTTCCCAAACAATTACGTCATCTCGAGATGACGTAATTGTTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-685s1c1
Sequence:CCGGCGGAGACAGCTTGATGAGAATCTCGAGATTCTCATCAAGCTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152550
SH3RF2 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing ring finger 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152550.3-1600s21c1
Sequence:CCGGCTACACCACATGGACGTTATCCTCGAGGATAACGTCCATGTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152550.3-2816s21c1
Sequence:CCGGTGCTTCTTTGACCTTACAATACTCGAGTATTGTAAGGTCAAAGAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152550.3-874s21c1
Sequence:CCGGGACCTTCCTCAAGGACGATATCTCGAGATATCGTCCTTGAGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-916s1c1
Sequence:CCGGGAAGGCAAGTTAGGAGATAAACTCGAGTTTATCTCCTAACTTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-924s1c1
Sequence:CCGGGTTAGGAGATAAAGTAGGCATCTCGAGATGCCTACTTTATCTCCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-1512s1c1
Sequence:CCGGCTTCCCAAACAATTACGTCATCTCGAGATGACGTAATTGTTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152550.1-685s1c1
Sequence:CCGGCGGAGACAGCTTGATGAGAATCTCGAGATTCTCATCAAGCTGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172966
SH3RF2 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing ring finger 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172966.1-2620s1c1
Sequence:CCGGCGCTCAATATAGAACATCTTTCTCGAGAAAGATGTTCTATATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-1847s1c1
Sequence:CCGGGAAACGCCCATCAAGAGTGAACTCGAGTTCACTCTTGATGGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-2088s1c1
Sequence:CCGGCCATTCTATTTGCCCACCGAACTCGAGTTCGGTGGGCAAATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-1318s1c1
Sequence:CCGGCGACTATGTCATCCCAGTCTTCTCGAGAAGACTGGGATGACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-795s1c1
Sequence:CCGGGACATCAGTTATCACGCACAACTCGAGTTGTGCGTGATAACTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172966
SH3RF2 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing ring finger 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172966.1-2620s1c1
Sequence:CCGGCGCTCAATATAGAACATCTTTCTCGAGAAAGATGTTCTATATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-1847s1c1
Sequence:CCGGGAAACGCCCATCAAGAGTGAACTCGAGTTCACTCTTGATGGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-2088s1c1
Sequence:CCGGCCATTCTATTTGCCCACCGAACTCGAGTTCGGTGGGCAAATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-1318s1c1
Sequence:CCGGCGACTATGTCATCCCAGTCTTCTCGAGAAGACTGGGATGACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-795s1c1
Sequence:CCGGGACATCAGTTATCACGCACAACTCGAGTTGTGCGTGATAACTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172966
SH3RF2 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing ring finger 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172966.1-2620s1c1
Sequence:CCGGCGCTCAATATAGAACATCTTTCTCGAGAAAGATGTTCTATATTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-1847s1c1
Sequence:CCGGGAAACGCCCATCAAGAGTGAACTCGAGTTCACTCTTGATGGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-2088s1c1
Sequence:CCGGCCATTCTATTTGCCCACCGAACTCGAGTTCGGTGGGCAAATAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-1318s1c1
Sequence:CCGGCGACTATGTCATCCCAGTCTTCTCGAGAAGACTGGGATGACATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172966.1-795s1c1
Sequence:CCGGGACATCAGTTATCACGCACAACTCGAGTTGTGCGTGATAACTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks