EMAIL THIS PAGE TO A FRIEND

SH3RF3

SH3 domain containing ring finger 3

Synonyms: POSH2 SH3MD4
UniProtKB ID: Q8TEJ3, A0SDZ7, A8MPR1, Q8NDU1
Gene ID:
Mouse(237353) SH3 domain containing ring finger 3
Rat(294557) SH3 domain containing ring finger 3
cow(615501) SH3 domain containing ring finger 3
sheep(101109609) SH3 domain containing ring finger 3
naked mole-rat(101723560) SH3 domain containing ring finger 3
domestic guinea pig(100713199) SH3 domain containing ring finger 3
chicken(418731) SH3 domain containing ring finger 3
dog(481304) SH3 domain containing ring finger 3
domestic cat(101096386) SH3 domain containing ring finger 3
Horse(100060543) SH3 domain containing ring finger 3
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001099289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099289 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057661 MISSION® esiRNA esiRNA targeting mouse Sh3rf3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099289 Rosetta Predictions human pricing
XM_293090 Rosetta Predictions human pricing
XM_001054057 Rosetta Predictions rat pricing
XM_001054117 Rosetta Predictions rat pricing
XM_228347 Rosetta Predictions rat pricing
NM_172788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320439 predicted 3089
2 SASI_Hs02_00320440 predicted 2382
3 SASI_Hs02_00320441 predicted 2961
4 SASI_Hs02_00320442 predicted 715
5 SASI_Hs02_00320443 predicted 1247
6 SASI_Hs02_00320444 predicted 1133
7 SASI_Hs02_00320445 predicted 1149
8 SASI_Hs02_00320446 predicted 1191
9 SASI_Hs02_00320447 predicted 1452
10 SASI_Hs02_00320448 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261661 predicted 1473
2 SASI_Hs01_00261662 predicted 1764
3 SASI_Hs01_00261663 predicted 1732
4 SASI_Hs01_00261664 predicted 1541
5 SASI_Hs01_00261665 predicted 1061
6 SASI_Hs01_00261666 predicted 693
7 SASI_Hs01_00261667 predicted 1670
8 SASI_Hs01_00261668 predicted 577
9 SASI_Hs01_00261669 predicted 595
10 SASI_Hs01_00261670 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274527 predicted 1339
2 SASI_Rn02_00274528 predicted 390
3 SASI_Rn02_00274529 predicted 1908
4 SASI_Rn02_00274530 predicted 1190
5 SASI_Rn02_00274531 predicted 303
6 SASI_Rn02_00274532 predicted 744
7 SASI_Rn02_00274533 predicted 274
8 SASI_Rn02_00274534 predicted 273
9 SASI_Rn02_00274535 predicted 285
10 SASI_Rn02_00274536 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274798 predicted 2298
2 SASI_Rn02_00274799 predicted 1019
3 SASI_Rn02_00274800 predicted 473
4 SASI_Rn02_00274801 predicted 827
5 SASI_Rn02_00274802 predicted 1270
6 SASI_Rn02_00274803 predicted 1478
7 SASI_Rn02_00274804 predicted 1323
8 SASI_Rn02_00274805 predicted 644
9 SASI_Rn02_00274806 predicted 993
10 SASI_Rn02_00274807 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385012 predicted 1893
2 SASI_Rn02_00385013 predicted 623
3 SASI_Rn02_00385014 predicted 426
4 SASI_Rn02_00385015 predicted 656
5 SASI_Rn02_00385016 predicted 872
6 SASI_Rn02_00385017 predicted 1077
7 SASI_Rn02_00385018 predicted 923
8 SASI_Rn02_00385019 predicted 248
9 SASI_Rn02_00385020 predicted 596
10 SASI_Rn02_00385021 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344685 predicted 2948
2 SASI_Mm01_00139227 predicted 2950
3 SASI_Mm01_00139228 predicted 2767
4 SASI_Mm01_00139230 predicted 1742
5 SASI_Mm02_00344686 predicted 2231
6 SASI_Mm01_00139232 predicted 1136
7 SASI_Mm01_00139233 predicted 2745
8 SASI_Mm02_00344687 predicted 761
9 SASI_Mm02_00344688 predicted 335
10 SASI_Mm02_00344689 predicted 391
11 SASI_Mm01_00139229 predicted 2281
12 SASI_Mm01_00139231 predicted 2248
13 SASI_Mm01_00139234 predicted 2225
14 SASI_Mm01_00139235 predicted 2289
15 SASI_Mm01_00139236 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172788
SH3RF3 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing ring finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172788.2-2206s1c1
Sequence:CCGGGCCAGAAACAAGCCGATGATTCTCGAGAATCATCGGCTTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-290s1c1
Sequence:CCGGCCTTCACTAAGGACGAAGTTTCTCGAGAAACTTCGTCCTTAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-1045s1c1
Sequence:CCGGGCTGGGTTACCCTGGAATAATCTCGAGATTATTCCAGGGTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-414s1c1
Sequence:CCGGGCAACTCATTGAGATGGACAACTCGAGTTGTCCATCTCAATGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-861s1c1
Sequence:CCGGCCTGGCTCTCTATGCATACAACTCGAGTTGTATGCATAGAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172788
SH3RF3 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing ring finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172788.2-2206s1c1
Sequence:CCGGGCCAGAAACAAGCCGATGATTCTCGAGAATCATCGGCTTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-290s1c1
Sequence:CCGGCCTTCACTAAGGACGAAGTTTCTCGAGAAACTTCGTCCTTAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-1045s1c1
Sequence:CCGGGCTGGGTTACCCTGGAATAATCTCGAGATTATTCCAGGGTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-414s1c1
Sequence:CCGGGCAACTCATTGAGATGGACAACTCGAGTTGTCCATCTCAATGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-861s1c1
Sequence:CCGGCCTGGCTCTCTATGCATACAACTCGAGTTGTATGCATAGAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172788
SH3RF3 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing ring finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172788.2-2206s1c1
Sequence:CCGGGCCAGAAACAAGCCGATGATTCTCGAGAATCATCGGCTTGTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-290s1c1
Sequence:CCGGCCTTCACTAAGGACGAAGTTTCTCGAGAAACTTCGTCCTTAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-1045s1c1
Sequence:CCGGGCTGGGTTACCCTGGAATAATCTCGAGATTATTCCAGGGTAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-414s1c1
Sequence:CCGGGCAACTCATTGAGATGGACAACTCGAGTTGTCCATCTCAATGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172788.2-861s1c1
Sequence:CCGGCCTGGCTCTCTATGCATACAACTCGAGTTGTATGCATAGAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099289
VALIDATED
SH3RF3 MISSION shRNA Bacterial Glycerol Stock
SH3 domain containing ring finger 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099289.1-2534s21c1
Sequence:CCGGAGGAAGGCGACATCGTCTTTGCTCGAGCAAAGACGATGTCGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099289.1-2382s21c1
Sequence:CCGGGGCAGGCTCCTTGGATCTAAACTCGAGTTTAGATCCAAGGAGCCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099289.1-797s21c1
Sequence:CCGGATTTCGAGATGAAGGACAAAGCTCGAGCTTTGTCCTTCATCTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099289.1-839s21c1
Sequence:CCGGCCTTCACCAAGGACGAGATTCCTCGAGGAATCTCGTCCTTGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099289.1-3669s21c1
Sequence:CCGGTCGAGGAAGGGCCACTATAATCTCGAGATTATAGTGGCCCTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099289
VALIDATED
SH3RF3 MISSION shRNA shRNA Plasmid DNA
SH3 domain containing ring finger 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099289.1-2534s21c1
Sequence:CCGGAGGAAGGCGACATCGTCTTTGCTCGAGCAAAGACGATGTCGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099289.1-2382s21c1
Sequence:CCGGGGCAGGCTCCTTGGATCTAAACTCGAGTTTAGATCCAAGGAGCCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099289.1-797s21c1
Sequence:CCGGATTTCGAGATGAAGGACAAAGCTCGAGCTTTGTCCTTCATCTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099289.1-839s21c1
Sequence:CCGGCCTTCACCAAGGACGAGATTCCTCGAGGAATCTCGTCCTTGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099289.1-3669s21c1
Sequence:CCGGTCGAGGAAGGGCCACTATAATCTCGAGATTATAGTGGCCCTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099289
VALIDATED
SH3RF3 MISSION shRNA Lentiviral Transduction Particles
SH3 domain containing ring finger 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099289.1-2534s21c1
Sequence:CCGGAGGAAGGCGACATCGTCTTTGCTCGAGCAAAGACGATGTCGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099289.1-2382s21c1
Sequence:CCGGGGCAGGCTCCTTGGATCTAAACTCGAGTTTAGATCCAAGGAGCCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099289.1-797s21c1
Sequence:CCGGATTTCGAGATGAAGGACAAAGCTCGAGCTTTGTCCTTCATCTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001099289.1-839s21c1
Sequence:CCGGCCTTCACCAAGGACGAGATTCCTCGAGGAATCTCGTCCTTGGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099289.1-3669s21c1
Sequence:CCGGTCGAGGAAGGGCCACTATAATCTCGAGATTATAGTGGCCCTTCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks