EMAIL THIS PAGE TO A FRIEND

SHC4

SHC (Src homology 2 domain containing) family, member 4

Synonyms: RaLP SHCD
UniProtKB ID: Q6S5L8, Q6UXQ3, Q8IYW3
Gene ID:
Mouse(271849) SHC (Src homology 2 domain containing) family, member 4
Rat(679845) SHC (Src homology 2 domain containing) family, member 4
chicken(426482) SHC (Src homology 2 domain containing) family, member 4
domestic cat(101099050) SHC (Src homology 2 domain containing) family, member 4
Horse(100055699) SHC (Src homology 2 domain containing) family, member 4
dog(487546) SHC (Src homology 2 domain containing) family, member 4
cow(524734) SHC (Src homology 2 domain containing) family, member 4
sheep(101110241) SHC (Src homology 2 domain containing) family, member 4
domestic guinea pig(100717842) SHC (Src homology 2 domain containing) family, member 4
naked mole-rat(101717788) SHC (Src homology 2 domain containing) family, member 4
Domestic Rabbit(100350676) SHC (Src homology 2 domain containing) family, member 4
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203349 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203349 Rosetta Predictions human pricing
XM_001054695 Rosetta Predictions rat pricing
NM_199022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373285 predicted 2248
2 SASI_Hs01_00022202 predicted 1686
3 SASI_Hs01_00022203 predicted 1284
4 SASI_Hs01_00022204 predicted 1375
5 SASI_Hs01_00022205 predicted 1057
6 SASI_Hs01_00022206 predicted 1444
7 SASI_Hs01_00022207 predicted 1724
8 SASI_Hs02_00373286 predicted 1527
9 SASI_Hs01_00022208 predicted 2260
10 SASI_Hs01_00022209 predicted 1581
11 SASI_Hs01_00022210 predicted 1764
12 SASI_Hs01_00022211 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276869 predicted 1207
2 SASI_Rn02_00276870 predicted 1093
3 SASI_Rn02_00276871 predicted 927
4 SASI_Rn02_00276872 predicted 1816
5 SASI_Rn02_00276873 predicted 1046
6 SASI_Rn02_00276874 predicted 787
7 SASI_Rn02_00276875 predicted 1014
8 SASI_Rn02_00276876 predicted 1027
9 SASI_Rn02_00276877 predicted 1405
10 SASI_Rn02_00276878 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351279 predicted 1416
2 SASI_Mm01_00073765 predicted 2749
3 SASI_Mm01_00073766 predicted 1403
4 SASI_Mm01_00073768 predicted 2585
5 SASI_Mm01_00073769 predicted 1626
6 SASI_Mm01_00073770 predicted 2413
7 SASI_Mm01_00073771 predicted 2639
8 SASI_Mm01_00073772 predicted 1500
9 SASI_Mm01_00073773 predicted 1720
10 SASI_Mm01_00073774 predicted 1367
11 SASI_Mm01_00073767 predicted 2598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199022
SHC4 MISSION shRNA Bacterial Glycerol Stock
SHC (Src homology 2 domain containing) family, member 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-603s1c1
Sequence:CCGGGCTGCATTGAAGTGCTGCAATCTCGAGATTGCAGCACTTCAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-47s1c1
Sequence:CCGGACGCTGTATGTAGGACTCTTTCTCGAGAAAGAGTCCTACATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-477s1c1
Sequence:CCGGCCTCTTTGCGTCCTGATACTTCTCGAGAAGTATCAGGACGCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-655s1c1
Sequence:CCGGCCAAGTTACAAGGGAAGCAATCTCGAGATTGCTTCCCTTGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-1266s1c1
Sequence:CCGGGCGGTGTGTATAAGAACTGTACTCGAGTACAGTTCTTATACACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199022.2-1745s21c1
Sequence:CCGGGAATGGCCCAAGACGTCATAACTCGAGTTATGACGTCTTGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199022.2-1948s21c1
Sequence:CCGGGCTCAAGCTACAGACCAAATGCTCGAGCATTTGGTCTGTAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199022.2-2985s21c1
Sequence:CCGGTACGTGCCTTTACCTTGATAACTCGAGTTATCAAGGTAAAGGCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199022
SHC4 MISSION shRNA shRNA Plasmid DNA
SHC (Src homology 2 domain containing) family, member 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-603s1c1
Sequence:CCGGGCTGCATTGAAGTGCTGCAATCTCGAGATTGCAGCACTTCAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-47s1c1
Sequence:CCGGACGCTGTATGTAGGACTCTTTCTCGAGAAAGAGTCCTACATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-477s1c1
Sequence:CCGGCCTCTTTGCGTCCTGATACTTCTCGAGAAGTATCAGGACGCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-655s1c1
Sequence:CCGGCCAAGTTACAAGGGAAGCAATCTCGAGATTGCTTCCCTTGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-1266s1c1
Sequence:CCGGGCGGTGTGTATAAGAACTGTACTCGAGTACAGTTCTTATACACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199022.2-1745s21c1
Sequence:CCGGGAATGGCCCAAGACGTCATAACTCGAGTTATGACGTCTTGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199022.2-1948s21c1
Sequence:CCGGGCTCAAGCTACAGACCAAATGCTCGAGCATTTGGTCTGTAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199022.2-2985s21c1
Sequence:CCGGTACGTGCCTTTACCTTGATAACTCGAGTTATCAAGGTAAAGGCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199022
SHC4 MISSION shRNA Lentiviral Transduction Particles
SHC (Src homology 2 domain containing) family, member 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-603s1c1
Sequence:CCGGGCTGCATTGAAGTGCTGCAATCTCGAGATTGCAGCACTTCAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-47s1c1
Sequence:CCGGACGCTGTATGTAGGACTCTTTCTCGAGAAAGAGTCCTACATACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-477s1c1
Sequence:CCGGCCTCTTTGCGTCCTGATACTTCTCGAGAAGTATCAGGACGCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-655s1c1
Sequence:CCGGCCAAGTTACAAGGGAAGCAATCTCGAGATTGCTTCCCTTGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199022.1-1266s1c1
Sequence:CCGGGCGGTGTGTATAAGAACTGTACTCGAGTACAGTTCTTATACACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199022.2-1745s21c1
Sequence:CCGGGAATGGCCCAAGACGTCATAACTCGAGTTATGACGTCTTGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199022.2-1948s21c1
Sequence:CCGGGCTCAAGCTACAGACCAAATGCTCGAGCATTTGGTCTGTAGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199022.2-2985s21c1
Sequence:CCGGTACGTGCCTTTACCTTGATAACTCGAGTTATCAAGGTAAAGGCACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203349
SHC4 MISSION shRNA Bacterial Glycerol Stock
SHC (Src homology 2 domain containing) family, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-2264s1c1
Sequence:CCGGGCCTTAAACAACCAGTGAGAACTCGAGTTCTCACTGGTTGTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1760s1c1
Sequence:CCGGCCCAGCGAGATACCTCATTATCTCGAGATAATGAGGTATCTCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1761s1c1
Sequence:CCGGCCAGCGAGATACCTCATTATTCTCGAGAATAATGAGGTATCTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203349.2-2990s1c1
Sequence:CCGGGCCTAGCATTTCTCAGTGTTTCTCGAGAAACACTGAGAAATGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1372s1c1
Sequence:CCGGCGAGCCTGTCACATATTGGAACTCGAGTTCCAATATGTGACAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203349.3-1337s21c1
Sequence:CCGGATGTTGCCTACGTAGCTAAAGCTCGAGCTTTAGCTACGTAGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203349.3-2332s21c1
Sequence:CCGGAGCACCATCACACTGATATTTCTCGAGAAATATCAGTGTGATGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203349.3-1403s21c1
Sequence:CCGGGAATGGCCCAAGACGTCATAACTCGAGTTATGACGTCTTGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203349
SHC4 MISSION shRNA shRNA Plasmid DNA
SHC (Src homology 2 domain containing) family, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-2264s1c1
Sequence:CCGGGCCTTAAACAACCAGTGAGAACTCGAGTTCTCACTGGTTGTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1760s1c1
Sequence:CCGGCCCAGCGAGATACCTCATTATCTCGAGATAATGAGGTATCTCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1761s1c1
Sequence:CCGGCCAGCGAGATACCTCATTATTCTCGAGAATAATGAGGTATCTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203349.2-2990s1c1
Sequence:CCGGGCCTAGCATTTCTCAGTGTTTCTCGAGAAACACTGAGAAATGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1372s1c1
Sequence:CCGGCGAGCCTGTCACATATTGGAACTCGAGTTCCAATATGTGACAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203349.3-1337s21c1
Sequence:CCGGATGTTGCCTACGTAGCTAAAGCTCGAGCTTTAGCTACGTAGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203349.3-2332s21c1
Sequence:CCGGAGCACCATCACACTGATATTTCTCGAGAAATATCAGTGTGATGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203349.3-1403s21c1
Sequence:CCGGGAATGGCCCAAGACGTCATAACTCGAGTTATGACGTCTTGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203349
SHC4 MISSION shRNA Lentiviral Transduction Particles
SHC (Src homology 2 domain containing) family, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-2264s1c1
Sequence:CCGGGCCTTAAACAACCAGTGAGAACTCGAGTTCTCACTGGTTGTTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1760s1c1
Sequence:CCGGCCCAGCGAGATACCTCATTATCTCGAGATAATGAGGTATCTCGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1761s1c1
Sequence:CCGGCCAGCGAGATACCTCATTATTCTCGAGAATAATGAGGTATCTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203349.2-2990s1c1
Sequence:CCGGGCCTAGCATTTCTCAGTGTTTCTCGAGAAACACTGAGAAATGCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203349.2-1372s1c1
Sequence:CCGGCGAGCCTGTCACATATTGGAACTCGAGTTCCAATATGTGACAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203349.3-1337s21c1
Sequence:CCGGATGTTGCCTACGTAGCTAAAGCTCGAGCTTTAGCTACGTAGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203349.3-2332s21c1
Sequence:CCGGAGCACCATCACACTGATATTTCTCGAGAAATATCAGTGTGATGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203349.3-1403s21c1
Sequence:CCGGGAATGGCCCAAGACGTCATAACTCGAGTTATGACGTCTTGGGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks