EMAIL THIS PAGE TO A FRIEND

SIGLEC5

sialic acid binding Ig-like lectin 5

Synonyms: CD170 CD33L2 OB-BP2 OBBP2 SIGLEC-5
UniProtKB ID: O15389
Gene ID:
Human(8778) Summary: This gene encodes a member of the sialic acid-binding immunoglobulin-like lectin (Siglec) family. These cell surface lectins are characterized by structural motifs in the immunoglobulin (Ig)-like domains and sialic acid recognition sites in the first Ig V set domain. The encoded protein is a member of the CD33-related subset of Siglecs and inhibits the activation of several cell types including monocytes, macrophages and neutrophils. Binding of group B Streptococcus (GBS) to the encoded protein plays a role in GBS immune evasion. [provided by RefSeq, Feb 2012]
Mouse(233186) sialic acid binding Ig-like lectin 5
Rat(292843) sialic acid binding Ig-like lectin 5
dog(476396) sialic acid binding Ig-like lectin 5
domestic cat(101094223) sialic acid binding Ig-like lectin 5
domestic guinea pig(100736000) sialic acid binding Ig-like lectin 5
naked mole-rat(101708758) sialic acid binding Ig-like lectin 5
cow(100300478) sialic acid binding Ig-like lectin 5
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003830 Rosetta Predictions human pricing
NM_001106249 Rosetta Predictions rat pricing
NM_145581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244344 predicted 1030
2 SASI_Hs01_00244346 predicted 1030
3 SASI_Hs01_00244347 predicted 527
4 SASI_Hs01_00244348 predicted 844
5 SASI_Hs01_00244349 predicted 476
6 SASI_Hs01_00244350 predicted 577
7 SASI_Hs01_00244351 predicted 770
8 SASI_Hs01_00244352 predicted 576
9 SASI_Hs01_00244353 predicted 1080
10 SASI_Hs02_00336388 predicted 1473
11 SASI_Hs01_00244345 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217108 predicted 263
2 SASI_Rn02_00217109 predicted 1883
3 SASI_Rn02_00217110 predicted 935
4 SASI_Rn02_00217111 predicted 429
5 SASI_Rn02_00217112 predicted 1837
6 SASI_Rn02_00217113 predicted 1755
7 SASI_Rn02_00217114 predicted 1846
8 SASI_Rn02_00217115 predicted 603
9 SASI_Rn02_00217116 predicted 1749
10 SASI_Rn02_00217117 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172172 predicted 1839
2 SASI_Mm01_00172173 predicted 1828
3 SASI_Mm01_00172174 predicted 1216
4 SASI_Mm01_00172175 predicted 214
5 SASI_Mm01_00172176 predicted 692
6 SASI_Mm01_00172177 predicted 1744
7 SASI_Mm01_00172178 predicted 1445
8 SASI_Mm01_00172179 predicted 762
9 SASI_Mm01_00172180 predicted 1318
10 SASI_Mm01_00172181 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003830
SIGLEC5 MISSION shRNA Bacterial Glycerol Stock
sialic acid binding Ig-like lectin 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-532s1c1
Sequence:CCGGCCAACAGAATAAGCTGAACTTCTCGAGAAGTTCAGCTTATTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1035s1c1
Sequence:CCGGTCTTGGAGCTTCGTCGAGTAACTCGAGTTACTCGACGAAGCTCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1097s1c1
Sequence:CCGGCCGCTGGGCTTCCTGCAAATTCTCGAGAATTTGCAGGAAGCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1774s1c1
Sequence:CCGGCTCGGAGATCAAGACAAGCAACTCGAGTTGCTTGTCTTGATCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-565s1c1
Sequence:CCGGCCTGATAGAGAAACCCGACATCTCGAGATGTCGGGTTTCTCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003830.2-1520s21c1
Sequence:CCGGATAGTGAAAGCCCGCAGGAAGCTCGAGCTTCCTGCGGGCTTTCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003830.2-2051s21c1
Sequence:CCGGCAAAGGTTGTTGTGAACATTACTCGAGTAATGTTCACAACAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003830.2-1940s21c1
Sequence:CCGGATTAGAGAGGTGGGCTCAAATCTCGAGATTTGAGCCCACCTCTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003830
SIGLEC5 MISSION shRNA shRNA Plasmid DNA
sialic acid binding Ig-like lectin 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-532s1c1
Sequence:CCGGCCAACAGAATAAGCTGAACTTCTCGAGAAGTTCAGCTTATTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1035s1c1
Sequence:CCGGTCTTGGAGCTTCGTCGAGTAACTCGAGTTACTCGACGAAGCTCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1097s1c1
Sequence:CCGGCCGCTGGGCTTCCTGCAAATTCTCGAGAATTTGCAGGAAGCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1774s1c1
Sequence:CCGGCTCGGAGATCAAGACAAGCAACTCGAGTTGCTTGTCTTGATCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-565s1c1
Sequence:CCGGCCTGATAGAGAAACCCGACATCTCGAGATGTCGGGTTTCTCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003830.2-1520s21c1
Sequence:CCGGATAGTGAAAGCCCGCAGGAAGCTCGAGCTTCCTGCGGGCTTTCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003830.2-2051s21c1
Sequence:CCGGCAAAGGTTGTTGTGAACATTACTCGAGTAATGTTCACAACAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003830.2-1940s21c1
Sequence:CCGGATTAGAGAGGTGGGCTCAAATCTCGAGATTTGAGCCCACCTCTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003830
SIGLEC5 MISSION shRNA Lentiviral Transduction Particles
sialic acid binding Ig-like lectin 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-532s1c1
Sequence:CCGGCCAACAGAATAAGCTGAACTTCTCGAGAAGTTCAGCTTATTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1035s1c1
Sequence:CCGGTCTTGGAGCTTCGTCGAGTAACTCGAGTTACTCGACGAAGCTCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1097s1c1
Sequence:CCGGCCGCTGGGCTTCCTGCAAATTCTCGAGAATTTGCAGGAAGCCCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-1774s1c1
Sequence:CCGGCTCGGAGATCAAGACAAGCAACTCGAGTTGCTTGTCTTGATCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003830.1-565s1c1
Sequence:CCGGCCTGATAGAGAAACCCGACATCTCGAGATGTCGGGTTTCTCTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003830.2-1520s21c1
Sequence:CCGGATAGTGAAAGCCCGCAGGAAGCTCGAGCTTCCTGCGGGCTTTCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003830.2-2051s21c1
Sequence:CCGGCAAAGGTTGTTGTGAACATTACTCGAGTAATGTTCACAACAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003830.2-1940s21c1
Sequence:CCGGATTAGAGAGGTGGGCTCAAATCTCGAGATTTGAGCCCACCTCTCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145581
SIGLEC5 MISSION shRNA Bacterial Glycerol Stock
sialic acid binding Ig-like lectin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145581.1-1844s1c1
Sequence:CCGGGCCCTCTAAACCAAAGGCTATCTCGAGATAGCCTTTGGTTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1501s1c1
Sequence:CCGGCACCATAAATAGTGCAAGCATCTCGAGATGCTTGCACTATTTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1497s1c1
Sequence:CCGGCCTCCACCATAAATAGTGCAACTCGAGTTGCACTATTTATGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1256s1c1
Sequence:CCGGGCTTGGAGTGACAATAGAGTTCTCGAGAACTCTATTGTCACTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1690s1c1
Sequence:CCGGGCCTCAGAACACGGAGGCTATCTCGAGATAGCCTCCGTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145581
SIGLEC5 MISSION shRNA shRNA Plasmid DNA
sialic acid binding Ig-like lectin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145581.1-1844s1c1
Sequence:CCGGGCCCTCTAAACCAAAGGCTATCTCGAGATAGCCTTTGGTTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1501s1c1
Sequence:CCGGCACCATAAATAGTGCAAGCATCTCGAGATGCTTGCACTATTTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1497s1c1
Sequence:CCGGCCTCCACCATAAATAGTGCAACTCGAGTTGCACTATTTATGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1256s1c1
Sequence:CCGGGCTTGGAGTGACAATAGAGTTCTCGAGAACTCTATTGTCACTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1690s1c1
Sequence:CCGGGCCTCAGAACACGGAGGCTATCTCGAGATAGCCTCCGTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145581
SIGLEC5 MISSION shRNA Lentiviral Transduction Particles
sialic acid binding Ig-like lectin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094304    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145581.1-1844s1c1
Sequence:CCGGGCCCTCTAAACCAAAGGCTATCTCGAGATAGCCTTTGGTTTAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1501s1c1
Sequence:CCGGCACCATAAATAGTGCAAGCATCTCGAGATGCTTGCACTATTTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1497s1c1
Sequence:CCGGCCTCCACCATAAATAGTGCAACTCGAGTTGCACTATTTATGGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1256s1c1
Sequence:CCGGGCTTGGAGTGACAATAGAGTTCTCGAGAACTCTATTGTCACTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145581.1-1690s1c1
Sequence:CCGGGCCTCAGAACACGGAGGCTATCTCGAGATAGCCTCCGTGTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks