EMAIL THIS PAGE TO A FRIEND

SIPA1L2

signal-induced proliferation-associated 1 like 2

Synonyms: SPAL2
Gene ID:
Mouse(244668) signal-induced proliferation-associated 1 like 2
Rat(361442) signal-induced proliferation-associated 1 like 2
Zebrafish(100331556) signal-induced proliferation-associated 1 like 2
chicken(421523) signal-induced proliferation-associated 1 like 2
dog(488969) signal-induced proliferation-associated 1 like 2
Horse(100060169) signal-induced proliferation-associated 1 like 2
domestic cat(101089465) signal-induced proliferation-associated 1 like 2
cow(535132) signal-induced proliferation-associated 1 like 2
sheep(101112448) signal-induced proliferation-associated 1 like 2
domestic guinea pig(100732957) signal-induced proliferation-associated 1 like 2
naked mole-rat(101707496) signal-induced proliferation-associated 1 like 2
Domestic Rabbit(100348416) signal-induced proliferation-associated 1 like 2
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020808 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020808 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020808 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067511 MISSION® esiRNA esiRNA human SIPA1L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020808 Rosetta Predictions human pricing
NM_001009704 Rosetta Predictions rat pricing
NM_001081337 Rosetta Predictions mouse pricing
XM_146572 Rosetta Predictions mouse pricing
XM_895104 Rosetta Predictions mouse pricing
XM_902817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020808 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353986 predicted 1366
2 SASI_Hs01_00085896 predicted 3716
3 SASI_Hs01_00085897 predicted 2951
4 SASI_Hs02_00353987 predicted 4090
5 SASI_Hs01_00085899 predicted 4399
6 SASI_Hs01_00085900 predicted 2424
7 SASI_Hs02_00353988 predicted 558
8 SASI_Hs01_00085902 predicted 2359
9 SASI_Hs01_00085903 predicted 1465
10 SASI_Hs02_00353989 predicted 234
11 SASI_Hs01_00085898 predicted 4441
12 SASI_Hs01_00085901 predicted 925
13 SASI_Hs01_00085904 predicted 2927
14 SASI_Hs01_00085905 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072568 predicted 866
2 SASI_Rn01_00072570 predicted 2797
3 SASI_Rn01_00072571 predicted 4692
4 SASI_Rn01_00072572 predicted 2487
5 SASI_Rn01_00072573 predicted 1300
6 SASI_Rn01_00072574 predicted 1909
7 SASI_Rn02_00199767 predicted 2631
8 SASI_Rn01_00072575 predicted 2468
9 SASI_Rn01_00072576 predicted 1313
10 SASI_Rn01_00072577 predicted 2867
11 SASI_Rn01_00072569 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297421 predicted 5236
2 SASI_Mm02_00297422 predicted 2118
3 SASI_Mm02_00297423 predicted 1001
4 SASI_Mm02_00297424 predicted 3275
5 SASI_Mm02_00297425 predicted 1096
6 SASI_Mm02_00297426 predicted 349
7 SASI_Mm02_00297427 predicted 1607
8 SASI_Mm02_00297428 predicted 2962
9 SASI_Mm02_00297429 predicted 2140
10 SASI_Mm02_00297430 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243827 predicted 2474
2 SASI_Mm01_00243828 predicted 1361
3 SASI_Mm01_00243829 predicted 3633
4 SASI_Mm01_00243830 predicted 1452
5 SASI_Mm01_00243831 predicted 710
6 SASI_Mm01_00243832 predicted 1959
7 SASI_Mm01_00243833 predicted 3318
8 SASI_Mm01_00243834 predicted 2499
9 SASI_Mm01_00243835 predicted 4731
10 SASI_Mm01_00243836 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207304 predicted 2116
2 SASI_Mm01_00207305 predicted 1002
3 SASI_Mm01_00207306 predicted 3277
4 SASI_Mm01_00207307 predicted 1094
5 SASI_Mm01_00207308 predicted 353
6 SASI_Mm01_00207309 predicted 1607
7 SASI_Mm01_00207310 predicted 2970
8 SASI_Mm01_00207311 predicted 2143
9 SASI_Mm01_00207312 predicted 4375
10 SASI_Mm01_00207313 predicted 1570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251416 predicted 2123
2 SASI_Mm01_00251417 predicted 1008
3 SASI_Mm01_00251418 predicted 3283
4 SASI_Mm01_00251419 predicted 1102
5 SASI_Mm01_00251420 predicted 349
6 SASI_Mm01_00251421 predicted 1606
7 SASI_Mm01_00251422 predicted 2968
8 SASI_Mm01_00251423 predicted 2145
9 SASI_Mm01_00251424 predicted 1569
10 SASI_Mm01_00251425 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020808
VALIDATED
SIPA1L2 MISSION shRNA Bacterial Glycerol Stock
signal-induced proliferation-associated 1 like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020808.3-4079s21c1
Sequence:CCGGCGACGAGCCAGCCAAGTTATACTCGAGTATAACTTGGCTGGCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020808.3-926s21c1
Sequence:CCGGCCGCATCTCAGGATTAGATTACTCGAGTAATCTAATCCTGAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020808.3-6221s21c1
Sequence:CCGGCACCCTTATTTAAGCTTATTTCTCGAGAAATAAGCTTAAATAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020808.3-4402s21c1
Sequence:CCGGCTGAATGTCCCGGGATGTATACTCGAGTATACATCCCGGGACATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020808.3-1607s21c1
Sequence:CCGGGGCCTATTATTACCGCAAATTCTCGAGAATTTGCGGTAATAATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020808.1-5510s1c1
Sequence:CCGGGCTTTGATGAAGTGTCTTGTACTCGAGTACAAGACACTTCATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020808.1-5241s1c1
Sequence:CCGGGCAGTTACCTTAGAGACTTATCTCGAGATAAGTCTCTAAGGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020808
VALIDATED
SIPA1L2 MISSION shRNA shRNA Plasmid DNA
signal-induced proliferation-associated 1 like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020808.3-4079s21c1
Sequence:CCGGCGACGAGCCAGCCAAGTTATACTCGAGTATAACTTGGCTGGCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020808.3-926s21c1
Sequence:CCGGCCGCATCTCAGGATTAGATTACTCGAGTAATCTAATCCTGAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020808.3-6221s21c1
Sequence:CCGGCACCCTTATTTAAGCTTATTTCTCGAGAAATAAGCTTAAATAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020808.3-4402s21c1
Sequence:CCGGCTGAATGTCCCGGGATGTATACTCGAGTATACATCCCGGGACATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020808.3-1607s21c1
Sequence:CCGGGGCCTATTATTACCGCAAATTCTCGAGAATTTGCGGTAATAATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020808.1-5510s1c1
Sequence:CCGGGCTTTGATGAAGTGTCTTGTACTCGAGTACAAGACACTTCATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020808.1-5241s1c1
Sequence:CCGGGCAGTTACCTTAGAGACTTATCTCGAGATAAGTCTCTAAGGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020808
VALIDATED
SIPA1L2 MISSION shRNA Lentiviral Transduction Particles
signal-induced proliferation-associated 1 like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020808.3-4079s21c1
Sequence:CCGGCGACGAGCCAGCCAAGTTATACTCGAGTATAACTTGGCTGGCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020808.3-926s21c1
Sequence:CCGGCCGCATCTCAGGATTAGATTACTCGAGTAATCTAATCCTGAGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020808.3-6221s21c1
Sequence:CCGGCACCCTTATTTAAGCTTATTTCTCGAGAAATAAGCTTAAATAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020808.3-4402s21c1
Sequence:CCGGCTGAATGTCCCGGGATGTATACTCGAGTATACATCCCGGGACATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020808.3-1607s21c1
Sequence:CCGGGGCCTATTATTACCGCAAATTCTCGAGAATTTGCGGTAATAATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020808.1-5510s1c1
Sequence:CCGGGCTTTGATGAAGTGTCTTGTACTCGAGTACAAGACACTTCATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148058    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020808.1-5241s1c1
Sequence:CCGGGCAGTTACCTTAGAGACTTATCTCGAGATAAGTCTCTAAGGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081337
SIPA1L2 MISSION shRNA Bacterial Glycerol Stock
signal-induced proliferation-associated 1 like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-766s21c1
Sequence:CCGGATAGAGAGTTATGACCCTAAACTCGAGTTTAGGGTCATAACTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-2520s21c1
Sequence:CCGGTACCCGAACAAGGCAAGAATACTCGAGTATTCTTGCCTTGTTCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081337.1-5823s21c1
Sequence:CCGGGTTGCTGTAGAGACGTATTTACTCGAGTAAATACGTCTCTACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-2116s21c1
Sequence:CCGGCACTCCCTCTATACCACATATCTCGAGATATGTGGTATAGAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-1529s21c1
Sequence:CCGGAGGTCAAACGCTACATCATAGCTCGAGCTATGATGTAGCGTTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081337
SIPA1L2 MISSION shRNA shRNA Plasmid DNA
signal-induced proliferation-associated 1 like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-766s21c1
Sequence:CCGGATAGAGAGTTATGACCCTAAACTCGAGTTTAGGGTCATAACTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-2520s21c1
Sequence:CCGGTACCCGAACAAGGCAAGAATACTCGAGTATTCTTGCCTTGTTCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081337.1-5823s21c1
Sequence:CCGGGTTGCTGTAGAGACGTATTTACTCGAGTAAATACGTCTCTACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-2116s21c1
Sequence:CCGGCACTCCCTCTATACCACATATCTCGAGATATGTGGTATAGAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-1529s21c1
Sequence:CCGGAGGTCAAACGCTACATCATAGCTCGAGCTATGATGTAGCGTTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081337
SIPA1L2 MISSION shRNA Lentiviral Transduction Particles
signal-induced proliferation-associated 1 like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-766s21c1
Sequence:CCGGATAGAGAGTTATGACCCTAAACTCGAGTTTAGGGTCATAACTCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-2520s21c1
Sequence:CCGGTACCCGAACAAGGCAAGAATACTCGAGTATTCTTGCCTTGTTCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081337.1-5823s21c1
Sequence:CCGGGTTGCTGTAGAGACGTATTTACTCGAGTAAATACGTCTCTACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-2116s21c1
Sequence:CCGGCACTCCCTCTATACCACATATCTCGAGATATGTGGTATAGAGGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081337.1-1529s21c1
Sequence:CCGGAGGTCAAACGCTACATCATAGCTCGAGCTATGATGTAGCGTTTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks