EMAIL THIS PAGE TO A FRIEND

SIRT2

sirtuin 2

Synonyms: SIR2 SIR2L SIR2L2
Gene ID:
Human(22933) Summary: This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Several transcript variants are resulted from alternative splicing of this gene. [provided by RefSeq, Jul 2010]
Mouse(64383) sirtuin 2
Rat(361532) sirtuin 2
fruit fly(42414) CG5085 gene product from transcript CG5085-RA
chicken(548628) sirtuin 2
dog(612558) sirtuin 2
Zebrafish(322309) sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S. cerevisiae)
cow(504463) sirtuin 2
sheep(101113169) sirtuin 2
Gene Class: Deacetylase
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
EPI010 Sirtuin 2 (SIRT2) Inhibitor Screening Assay Kit 100 assays in 96 well plates human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012237 Rosetta Predictions human pricing
NM_030593 Rosetta Predictions human pricing
NM_001008368 Rosetta Predictions rat pricing
NM_001122765 Rosetta Predictions mouse pricing
NM_001122766 Rosetta Predictions mouse pricing
NM_022432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223183 predicted 673
2 SASI_Hs01_00223184 predicted 1617
3 SASI_Hs01_00223185 predicted 915
4 SASI_Hs01_00223186 predicted 687
5 SASI_Hs01_00223187 predicted 1111
6 SASI_Hs01_00223189 predicted 538
7 SASI_Hs01_00223190 predicted 862
8 SASI_Hs01_00223191 predicted 495
9 SASI_Hs02_00343926 predicted 1042
10 SASI_Hs01_00223192 predicted 541
11 SASI_Hs01_00223188 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211931 predicted 620
2 SASI_Hs01_00211932 predicted 1561
3 SASI_Hs01_00211933 predicted 860
4 SASI_Hs01_00211934 predicted 625
5 SASI_Hs01_00211935 predicted 1061
6 SASI_Hs01_00211937 predicted 474
7 SASI_Hs01_00211938 predicted 803
8 SASI_Hs01_00211939 predicted 431
9 SASI_Hs02_00358161 predicted 991
10 SASI_Hs01_00211940 predicted 489
11 SASI_Hs01_00211936 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079751 predicted 938
2 SASI_Rn01_00079752 predicted 1603
3 SASI_Rn02_00199138 predicted 734
4 SASI_Rn01_00079753 predicted 652
5 SASI_Rn01_00079754 predicted 697
6 SASI_Rn01_00079755 predicted 686
7 SASI_Rn01_00079757 predicted 775
8 SASI_Rn01_00079758 predicted 1562
9 SASI_Rn01_00079759 predicted 476
10 SASI_Rn01_00079760 predicted 1109
11 SASI_Rn01_00079756 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309381 predicted 1296
2 SASI_Mm02_00309382 predicted 1450
3 SASI_Mm02_00309383 predicted 1196
4 SASI_Mm02_00309384 predicted 1405
5 SASI_Mm02_00309385 predicted 1540
6 SASI_Mm02_00309386 predicted 1463
7 SASI_Mm02_00309387 predicted 553
8 SASI_Mm02_00309388 predicted 619
9 SASI_Mm02_00309389 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309390 predicted 1129
2 SASI_Mm02_00309391 predicted 1284
3 SASI_Mm02_00309392 predicted 1037
4 SASI_Mm02_00309393 predicted 1238
5 SASI_Mm02_00309394 predicted 1378
6 SASI_Mm02_00309395 predicted 1305
7 SASI_Mm02_00309396 predicted 386
8 SASI_Mm02_00309397 predicted 456
9 SASI_Mm02_00309398 predicted 1129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326603 predicted 1336
2 SASI_Mm01_00155787 predicted 1495
3 SASI_Mm01_00155788 predicted 1248
4 SASI_Mm01_00155792 predicted 1454
5 SASI_Mm02_00326604 predicted 1586
6 SASI_Mm02_00326605 predicted 1509
7 SASI_Mm02_00326606 predicted 600
8 SASI_Mm02_00326607 predicted 658
9 SASI_Mm02_00326608 predicted 1338
10 SASI_Mm01_00155789 predicted 451
11 SASI_Mm01_00155790 predicted 346
12 SASI_Mm01_00155791 predicted 1351
13 SASI_Mm01_00155793 predicted 1322
14 SASI_Mm01_00155794 predicted 530
15 SASI_Mm01_00155795 predicted 1358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012237
VALIDATED
SIRT2 MISSION shRNA Bacterial Glycerol Stock
sirtuin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_012237.2-549s1c1
Sequence:CCGGGCCATCTTTGAGATCAGCTATCTCGAGATAGCTGATCTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_012237.2-815s1c1
Sequence:CCGGGCTAAGCTGGATGAAAGAGAACTCGAGTTCTCTTTCATCCAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012237.2-632s1c1
Sequence:CCGGGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012237.2-1046s1c1
Sequence:CCGGCCTGCTCATCAACAAGGAGAACTCGAGTTCTCCTTGTTGATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012237.2-1739s21c1
Sequence:CCGGCCTGTGGCTAAGTAAACCATACTCGAGTATGGTTTACTTAGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-510s21c1
Sequence:CCGGTATGACAACCTAGAGAAGTACCTCGAGGTACTTCTCTAGGTTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-632s21c1
Sequence:CCGGGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-549s21c1
Sequence:CCGGGCCATCTTTGAGATCAGCTATCTCGAGATAGCTGATCTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-815s21c1
Sequence:CCGGGCTAAGCTGGATGAAAGAGAACTCGAGTTCTCTTTCATCCAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012237
VALIDATED
SIRT2 MISSION shRNA shRNA Plasmid DNA
sirtuin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_012237.2-549s1c1
Sequence:CCGGGCCATCTTTGAGATCAGCTATCTCGAGATAGCTGATCTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_012237.2-815s1c1
Sequence:CCGGGCTAAGCTGGATGAAAGAGAACTCGAGTTCTCTTTCATCCAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012237.2-632s1c1
Sequence:CCGGGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012237.2-1046s1c1
Sequence:CCGGCCTGCTCATCAACAAGGAGAACTCGAGTTCTCCTTGTTGATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012237.2-1739s21c1
Sequence:CCGGCCTGTGGCTAAGTAAACCATACTCGAGTATGGTTTACTTAGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-510s21c1
Sequence:CCGGTATGACAACCTAGAGAAGTACCTCGAGGTACTTCTCTAGGTTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-632s21c1
Sequence:CCGGGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-549s21c1
Sequence:CCGGGCCATCTTTGAGATCAGCTATCTCGAGATAGCTGATCTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-815s21c1
Sequence:CCGGGCTAAGCTGGATGAAAGAGAACTCGAGTTCTCTTTCATCCAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012237
VALIDATED
SIRT2 MISSION shRNA Lentiviral Transduction Particles
sirtuin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_012237.2-549s1c1
Sequence:CCGGGCCATCTTTGAGATCAGCTATCTCGAGATAGCTGATCTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_012237.2-815s1c1
Sequence:CCGGGCTAAGCTGGATGAAAGAGAACTCGAGTTCTCTTTCATCCAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_012237.2-632s1c1
Sequence:CCGGGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_012237.2-1046s1c1
Sequence:CCGGCCTGCTCATCAACAAGGAGAACTCGAGTTCTCCTTGTTGATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012237.2-1739s21c1
Sequence:CCGGCCTGTGGCTAAGTAAACCATACTCGAGTATGGTTTACTTAGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-510s21c1
Sequence:CCGGTATGACAACCTAGAGAAGTACCTCGAGGTACTTCTCTAGGTTGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-632s21c1
Sequence:CCGGGCCAACCATCTGTCACTACTTCTCGAGAAGTAGTGACAGATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-549s21c1
Sequence:CCGGGCCATCTTTGAGATCAGCTATCTCGAGATAGCTGATCTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012237.2-815s21c1
Sequence:CCGGGCTAAGCTGGATGAAAGAGAACTCGAGTTCTCTTTCATCCAGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022432
SIRT2 MISSION shRNA Bacterial Glycerol Stock
sirtuin 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022432.2-1358s1c1
Sequence:CCGGCCTTCGTTCTTTAACCACTTTCTCGAGAAAGTGGTTAAAGAACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-603s1c1
Sequence:CCGGCAGAACATAGACACGCTGGAACTCGAGTTCCAGCGTGTCTATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-770s1c1
Sequence:CCGGGCAGTGTCAGAGCGTGGTAAACTCGAGTTTACCACGCTCTGACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-948s1c1
Sequence:CCGGCGGCTGCTCATTAACAAGGAACTCGAGTTCCTTGTTAATGAGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-410s1c1
Sequence:CCGGCCTCTATGCAAACCTGGAGAACTCGAGTTCTCCAGGTTTGCATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022432.4-767s21c1
Sequence:CCGGCAGTGTCAGAGTGTGGTAAAGCTCGAGCTTTACCACACTCTGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022432.4-438s21c1
Sequence:CCGGCTTACCCAGAGGCCATCTTTGCTCGAGCAAAGATGGCCTCTGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022432
SIRT2 MISSION shRNA shRNA Plasmid DNA
sirtuin 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022432.2-1358s1c1
Sequence:CCGGCCTTCGTTCTTTAACCACTTTCTCGAGAAAGTGGTTAAAGAACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-603s1c1
Sequence:CCGGCAGAACATAGACACGCTGGAACTCGAGTTCCAGCGTGTCTATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-770s1c1
Sequence:CCGGGCAGTGTCAGAGCGTGGTAAACTCGAGTTTACCACGCTCTGACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-948s1c1
Sequence:CCGGCGGCTGCTCATTAACAAGGAACTCGAGTTCCTTGTTAATGAGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-410s1c1
Sequence:CCGGCCTCTATGCAAACCTGGAGAACTCGAGTTCTCCAGGTTTGCATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022432.4-767s21c1
Sequence:CCGGCAGTGTCAGAGTGTGGTAAAGCTCGAGCTTTACCACACTCTGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022432.4-438s21c1
Sequence:CCGGCTTACCCAGAGGCCATCTTTGCTCGAGCAAAGATGGCCTCTGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022432
SIRT2 MISSION shRNA Lentiviral Transduction Particles
sirtuin 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022432.2-1358s1c1
Sequence:CCGGCCTTCGTTCTTTAACCACTTTCTCGAGAAAGTGGTTAAAGAACGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-603s1c1
Sequence:CCGGCAGAACATAGACACGCTGGAACTCGAGTTCCAGCGTGTCTATGTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-770s1c1
Sequence:CCGGGCAGTGTCAGAGCGTGGTAAACTCGAGTTTACCACGCTCTGACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-948s1c1
Sequence:CCGGCGGCTGCTCATTAACAAGGAACTCGAGTTCCTTGTTAATGAGCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022432.2-410s1c1
Sequence:CCGGCCTCTATGCAAACCTGGAGAACTCGAGTTCTCCAGGTTTGCATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022432.4-767s21c1
Sequence:CCGGCAGTGTCAGAGTGTGGTAAAGCTCGAGCTTTACCACACTCTGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022432.4-438s21c1
Sequence:CCGGCTTACCCAGAGGCCATCTTTGCTCGAGCAAAGATGGCCTCTGGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks