EMAIL THIS PAGE TO A FRIEND

SIRT3

sirtuin 3

Synonyms: SIR2L3
UniProtKB ID: Q9NTG7, B7Z5U6, Q9Y6E8
Gene ID:
Human(23410) Summary: This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class I of the sirtuin family. Two alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(64384) sirtuin 3
Rat(293615) sirtuin 3
cow(614027) sirtuin 3
sheep(101105454) sirtuin 3
Zebrafish(558775) sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)
dog(475933) sirtuin 3
chicken(422988) sirtuin (silent mating type information regulation 2 homolog) 3 (S. cerevisiae)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301489 ANTI-MOUSE SIRT3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, hamster
immunohistochemistry, western blot pricing
SAB2108473 Anti-SIRT3 affinity isolated antibody canine, human, rabbit, horse, guinea pig, mouse, rat, bovine
immunohistochemistry, western blot pricing
AV32389 Anti-SIRT3 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, rat, mouse, canine, rabbit, horse, rabbit, human
immunohistochemistry, western blot pricing
AV32388 Anti-SIRT3 (AB2) antibody produced in rabbit IgG fraction of antiserum zebrafish, rabbit, guinea pig, rabbit, human, rat, canine, mouse, horse
western blot pricing
SAB3500494 Anti-SIRT3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB2502006 Anti-Sirt3 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, mouse, human, rat
ELISA, western blot pricing
SAB2500945 Anti-SIRT3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
S4072 Anti-Sirt3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA026809 Anti-SIRT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1403135 Monoclonal Anti-SIRT3, (C-terminal) antibody produced in mouse clone 1A4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093591 MISSION® esiRNA esiRNA human SIRT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017524 Rosetta Predictions human pricing
NM_012239 Rosetta Predictions human pricing
NM_001106313 Rosetta Predictions rat pricing
NM_001127351 Rosetta Predictions mouse pricing
NM_022433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222977 predicted 1431
2 SASI_Hs01_00222978 predicted 605
3 SASI_Hs01_00222980 predicted 1145
4 SASI_Hs01_00222981 predicted 679
5 SASI_Hs01_00222982 predicted 569
6 SASI_Hs01_00222983 predicted 1397
7 SASI_Hs01_00222984 predicted 1117
8 SASI_Hs01_00222985 predicted 1188
9 SASI_Hs01_00222986 predicted 1549
10 SASI_Hs02_00306786 predicted 1481
11 SASI_Hs01_00222979 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091235 predicted 1569
2 SASI_Hs01_00091236 predicted 750
3 SASI_Hs01_00091238 predicted 1291
4 SASI_Hs01_00091239 predicted 832
5 SASI_Hs01_00091240 predicted 713
6 SASI_Hs01_00091241 predicted 1536
7 SASI_Hs01_00091242 predicted 1271
8 SASI_Hs01_00091243 predicted 1332
9 SASI_Hs01_00091244 predicted 1698
10 SASI_Hs02_00343929 predicted 1629
11 SASI_Hs01_00091237 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217748 predicted 437
2 SASI_Rn02_00217749 predicted 981
3 SASI_Rn02_00217750 predicted 483
4 SASI_Rn02_00217751 predicted 582
5 SASI_Rn02_00217752 predicted 277
6 SASI_Rn02_00217753 predicted 635
7 SASI_Rn02_00217754 predicted 674
8 SASI_Rn02_00217755 predicted 232
9 SASI_Rn02_00217756 predicted 438
10 SASI_Rn02_00217757 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310297 predicted 995
2 SASI_Mm02_00310298 predicted 715
3 SASI_Mm02_00310299 predicted 437
4 SASI_Mm02_00310300 predicted 660
5 SASI_Mm02_00310301 predicted 484
6 SASI_Mm02_00310302 predicted 990
7 SASI_Mm02_00310303 predicted 339
8 SASI_Mm02_00310304 predicted 519
9 SASI_Mm02_00310305 predicted 309
10 SASI_Mm02_00310306 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059010 predicted 1040
2 SASI_Mm01_00059011 predicted 762
3 SASI_Mm01_00059012 predicted 483
4 SASI_Mm01_00059013 predicted 705
5 SASI_Mm01_00059015 predicted 527
6 SASI_Mm01_00059016 predicted 1036
7 SASI_Mm02_00326609 predicted 389
8 SASI_Mm01_00059017 predicted 569
9 SASI_Mm01_00059018 predicted 355
10 SASI_Mm01_00059019 predicted 793
11 SASI_Mm01_00059014 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022433
VALIDATED
SIRT3 MISSION shRNA Bacterial Glycerol Stock
sirtuin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-483s21c1
Sequence:CCGGGCCCAATGTCACTCACTACTTCTCGAGAAGTAGTGAGTGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-1139s21c1
Sequence:CCGGAGACAGCTCCAACACGTTTACCTCGAGGTAAACGTGTTGGAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-400s21c1
Sequence:CCGGGCCATCTTTGAACTTGGCTTTCTCGAGAAAGCCAAGTTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-1007s21c1
Sequence:CCGGCACAAGAACTGCTGGATCTTACTCGAGTAAGATCCAGCAGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-399s1c1
Sequence:CCGGGCCATCTTTGAACTTGGCTTTCTCGAGAAAGCCAAGTTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-536s1c1
Sequence:CCGGGCGGCTCTATACACAGAACATCTCGAGATGTTCTGTGTATAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-482s1c1
Sequence:CCGGGCCCAATGTCACTCACTACTTCTCGAGAAGTAGTGAGTGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-1006s1c1
Sequence:CCGGCACAAGAACTGCTGGATCTTACTCGAGTAAGATCCAGCAGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022433.1-773s1c1
Sequence:CCGGCCTACTCCATATGGCTGACTTCTCGAGAAGTCAGCCATATGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022433
VALIDATED
SIRT3 MISSION shRNA shRNA Plasmid DNA
sirtuin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-483s21c1
Sequence:CCGGGCCCAATGTCACTCACTACTTCTCGAGAAGTAGTGAGTGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-1139s21c1
Sequence:CCGGAGACAGCTCCAACACGTTTACCTCGAGGTAAACGTGTTGGAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-400s21c1
Sequence:CCGGGCCATCTTTGAACTTGGCTTTCTCGAGAAAGCCAAGTTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-1007s21c1
Sequence:CCGGCACAAGAACTGCTGGATCTTACTCGAGTAAGATCCAGCAGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-399s1c1
Sequence:CCGGGCCATCTTTGAACTTGGCTTTCTCGAGAAAGCCAAGTTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-536s1c1
Sequence:CCGGGCGGCTCTATACACAGAACATCTCGAGATGTTCTGTGTATAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-482s1c1
Sequence:CCGGGCCCAATGTCACTCACTACTTCTCGAGAAGTAGTGAGTGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-1006s1c1
Sequence:CCGGCACAAGAACTGCTGGATCTTACTCGAGTAAGATCCAGCAGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022433.1-773s1c1
Sequence:CCGGCCTACTCCATATGGCTGACTTCTCGAGAAGTCAGCCATATGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022433
VALIDATED
SIRT3 MISSION shRNA Lentiviral Transduction Particles
sirtuin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-483s21c1
Sequence:CCGGGCCCAATGTCACTCACTACTTCTCGAGAAGTAGTGAGTGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-1139s21c1
Sequence:CCGGAGACAGCTCCAACACGTTTACCTCGAGGTAAACGTGTTGGAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-400s21c1
Sequence:CCGGGCCATCTTTGAACTTGGCTTTCTCGAGAAAGCCAAGTTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022433.2-1007s21c1
Sequence:CCGGCACAAGAACTGCTGGATCTTACTCGAGTAAGATCCAGCAGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-399s1c1
Sequence:CCGGGCCATCTTTGAACTTGGCTTTCTCGAGAAAGCCAAGTTCAAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-536s1c1
Sequence:CCGGGCGGCTCTATACACAGAACATCTCGAGATGTTCTGTGTATAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-482s1c1
Sequence:CCGGGCCCAATGTCACTCACTACTTCTCGAGAAGTAGTGAGTGACATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022433.1-1006s1c1
Sequence:CCGGCACAAGAACTGCTGGATCTTACTCGAGTAAGATCCAGCAGTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022433.1-773s1c1
Sequence:CCGGCCTACTCCATATGGCTGACTTCTCGAGAAGTCAGCCATATGGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012239
VALIDATED
SIRT3 MISSION shRNA Bacterial Glycerol Stock
sirtuin 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-350s21c1
Sequence:CCGGGTGGGTGCTTCAAGTGTTGTTCTCGAGAACAACACTTGAAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-650s21c1
Sequence:CCGGCCCAACGTCACTCACTACTTTCTCGAGAAAGTAGTGAGTGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-703s21c1
Sequence:CCGGGCGGCTCTACACGCAGAACATCTCGAGATGTTCTGCGTGTAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-939s21c1
Sequence:CCGGTCTTGCTGCATGTGGTTGATTCTCGAGAATCAACCACATGCAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-795s21c1
Sequence:CCGGCCACCTGCACAGTCTGCCAAACTCGAGTTTGGCAGACTGTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-863s1c1
Sequence:CCGGCCACCTGCACAGTCTGCCAAACTCGAGTTTGGCAGACTGTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-418s1c1
Sequence:CCGGGTGGGTGCTTCAAGTGTTGTTCTCGAGAACAACACTTGAAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-771s1c1
Sequence:CCGGGCGGCTCTACACGCAGAACATCTCGAGATGTTCTGCGTGTAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-718s1c1
Sequence:CCGGCCCAACGTCACTCACTACTTTCTCGAGAAAGTAGTGAGTGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012239
VALIDATED
SIRT3 MISSION shRNA shRNA Plasmid DNA
sirtuin 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-350s21c1
Sequence:CCGGGTGGGTGCTTCAAGTGTTGTTCTCGAGAACAACACTTGAAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-650s21c1
Sequence:CCGGCCCAACGTCACTCACTACTTTCTCGAGAAAGTAGTGAGTGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-703s21c1
Sequence:CCGGGCGGCTCTACACGCAGAACATCTCGAGATGTTCTGCGTGTAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-939s21c1
Sequence:CCGGTCTTGCTGCATGTGGTTGATTCTCGAGAATCAACCACATGCAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-795s21c1
Sequence:CCGGCCACCTGCACAGTCTGCCAAACTCGAGTTTGGCAGACTGTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-863s1c1
Sequence:CCGGCCACCTGCACAGTCTGCCAAACTCGAGTTTGGCAGACTGTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-418s1c1
Sequence:CCGGGTGGGTGCTTCAAGTGTTGTTCTCGAGAACAACACTTGAAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-771s1c1
Sequence:CCGGGCGGCTCTACACGCAGAACATCTCGAGATGTTCTGCGTGTAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-718s1c1
Sequence:CCGGCCCAACGTCACTCACTACTTTCTCGAGAAAGTAGTGAGTGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012239
VALIDATED
SIRT3 MISSION shRNA Lentiviral Transduction Particles
sirtuin 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-350s21c1
Sequence:CCGGGTGGGTGCTTCAAGTGTTGTTCTCGAGAACAACACTTGAAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-650s21c1
Sequence:CCGGCCCAACGTCACTCACTACTTTCTCGAGAAAGTAGTGAGTGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-703s21c1
Sequence:CCGGGCGGCTCTACACGCAGAACATCTCGAGATGTTCTGCGTGTAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-939s21c1
Sequence:CCGGTCTTGCTGCATGTGGTTGATTCTCGAGAATCAACCACATGCAGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012239.5-795s21c1
Sequence:CCGGCCACCTGCACAGTCTGCCAAACTCGAGTTTGGCAGACTGTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-863s1c1
Sequence:CCGGCCACCTGCACAGTCTGCCAAACTCGAGTTTGGCAGACTGTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-418s1c1
Sequence:CCGGGTGGGTGCTTCAAGTGTTGTTCTCGAGAACAACACTTGAAGCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-771s1c1
Sequence:CCGGGCGGCTCTACACGCAGAACATCTCGAGATGTTCTGCGTGTAGAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_012239.3-718s1c1
Sequence:CCGGCCCAACGTCACTCACTACTTTCTCGAGAAAGTAGTGAGTGACGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks