EMAIL THIS PAGE TO A FRIEND

SIRT4

sirtuin 4

Synonyms: SIR2L4
UniProtKB ID: Q9Y6E7, O43346, Q32M33
Gene ID:
Human(23409) Summary: This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]
Mouse(75387) sirtuin 4
Rat(304539) sirtuin 4
fruit fly(31480) CG3187 gene product from transcript CG3187-RC
dog(477507) sirtuin 4
chicken(416981) sirtuin 4
cow(519328) sirtuin 4
sheep(100217404) sirtuin 4
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500495 Anti-SIRT4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB2500946 Anti-SIRT4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1407208 Anti-SIRT4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108218 Anti-SIRT4 antibody produced in rabbit affinity isolated antibody rat, human, pig, bovine, horse, rabbit, mouse, guinea pig
immunohistochemistry, western blot pricing
SAB2108304 Anti-SIRT4 antibody produced in rabbit affinity isolated antibody human, horse, bovine, rabbit, rat, guinea pig, mouse
western blot pricing
S0948 Anti-SIRT4 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution mouse (predicted), human, rat (predicted)
immunofluorescence, western blot pricing
SAB2102155 Anti-SIRT4 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, bovine, rat, pig, human, mouse, horse
western blot pricing
HPA029691 Anti-SIRT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA029692 Anti-SIRT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
SAB2103969 Anti-SIRT4, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human, horse, bovine, rat, rabbit
western blot pricing
SAB1403134 Monoclonal Anti-SIRT4, (C-terminal) antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012240 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_485674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_485674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_485674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012240 Rosetta Predictions human pricing
NM_001107147 Rosetta Predictions rat pricing
XM_485674 Rosetta Predictions mouse pricing
XM_988059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060604 predicted 796
2 SASI_Hs01_00060605 predicted 405
3 SASI_Hs01_00060606 predicted 391
4 SASI_Hs01_00060607 predicted 860
5 SASI_Hs01_00060608 predicted 834
6 SASI_Hs01_00060609 predicted 889
7 SASI_Hs01_00060610 predicted 411
8 SASI_Hs01_00060611 predicted 395
9 SASI_Hs01_00060613 predicted 780
10 SASI_Hs02_00343930 predicted 812
11 SASI_Hs01_00060612 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225965 predicted 1014
2 SASI_Rn02_00225966 predicted 907
3 SASI_Rn02_00225967 predicted 952
4 SASI_Rn02_00225968 predicted 474
5 SASI_Rn02_00225969 predicted 544
6 SASI_Rn02_00225970 predicted 392
7 SASI_Rn02_00225971 predicted 1032
8 SASI_Rn02_00225972 predicted 306
9 SASI_Rn02_00225973 predicted 1333
10 SASI_Rn02_00225974 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246644 predicted 544
2 SASI_Mm01_00246645 predicted 520
3 SASI_Mm01_00246646 predicted 807
4 SASI_Mm01_00246647 predicted 771
5 SASI_Mm01_00246648 predicted 754
6 SASI_Mm01_00246650 predicted 510
7 SASI_Mm02_00426674 predicted 205
8 SASI_Mm01_00246651 predicted 657
9 SASI_Mm02_00426675 predicted 348
10 SASI_Mm01_00246652 predicted 916
11 SASI_Mm01_00246643 predicted 924
12 SASI_Mm01_00246649 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449536 predicted 915
2 SASI_Mm02_00449537 predicted 291
3 SASI_Mm02_00449538 predicted 616
4 SASI_Mm02_00449539 predicted 268
5 SASI_Mm02_00449540 predicted 552
6 SASI_Mm02_00449541 predicted 519
7 SASI_Mm02_00449542 predicted 505
8 SASI_Mm02_00449543 predicted 254
9 SASI_Mm02_00449544 predicted 404
10 SASI_Mm02_00449545 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012240
SIRT4 MISSION shRNA Bacterial Glycerol Stock
sirtuin 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-326s1c1
Sequence:CCGGCCAGCGGTACTGGGCGAGAAACTCGAGTTTCTCGCCCAGTACCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-164s1c1
Sequence:CCGGGCGCTTCATCACCCTTTCCAACTCGAGTTGGAAAGGGTGATGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-734s1c1
Sequence:CCGGGAACCCTGACAAGGTTGATTTCTCGAGAAATCAACCTTGTCAGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-860s1c1
Sequence:CCGGCCCGATTGCAATACTGAACATCTCGAGATGTTCAGTATTGCAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-87s1c1
Sequence:CCGGCCGTGCTCGAAAGCCTCCATTCTCGAGAATGGAGGCTTTCGAGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-619s21c1
Sequence:CCGGCTCCTGATGGTGACGTCTTTCCTCGAGGAAAGACGTCACCATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-734s21c1
Sequence:CCGGGAACCCTGACAAGGTTGATTTCTCGAGAAATCAACCTTGTCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-961s21c1
Sequence:CCGGGCTGACCACAGCCTGATATTCCTCGAGGAATATCAGGCTGTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012240.1-993s21c1
Sequence:CCGGACAGGGACTTTCACTTGAATCCTCGAGGATTCAAGTGAAAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-798s21c1
Sequence:CCGGGGATCATCCTTGCAGGTATACCTCGAGGTATACCTGCAAGGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012240
SIRT4 MISSION shRNA shRNA Plasmid DNA
sirtuin 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-326s1c1
Sequence:CCGGCCAGCGGTACTGGGCGAGAAACTCGAGTTTCTCGCCCAGTACCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-164s1c1
Sequence:CCGGGCGCTTCATCACCCTTTCCAACTCGAGTTGGAAAGGGTGATGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-734s1c1
Sequence:CCGGGAACCCTGACAAGGTTGATTTCTCGAGAAATCAACCTTGTCAGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-860s1c1
Sequence:CCGGCCCGATTGCAATACTGAACATCTCGAGATGTTCAGTATTGCAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-87s1c1
Sequence:CCGGCCGTGCTCGAAAGCCTCCATTCTCGAGAATGGAGGCTTTCGAGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-619s21c1
Sequence:CCGGCTCCTGATGGTGACGTCTTTCCTCGAGGAAAGACGTCACCATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-734s21c1
Sequence:CCGGGAACCCTGACAAGGTTGATTTCTCGAGAAATCAACCTTGTCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-961s21c1
Sequence:CCGGGCTGACCACAGCCTGATATTCCTCGAGGAATATCAGGCTGTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012240.1-993s21c1
Sequence:CCGGACAGGGACTTTCACTTGAATCCTCGAGGATTCAAGTGAAAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-798s21c1
Sequence:CCGGGGATCATCCTTGCAGGTATACCTCGAGGTATACCTGCAAGGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012240
SIRT4 MISSION shRNA Lentiviral Transduction Particles
sirtuin 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-326s1c1
Sequence:CCGGCCAGCGGTACTGGGCGAGAAACTCGAGTTTCTCGCCCAGTACCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-164s1c1
Sequence:CCGGGCGCTTCATCACCCTTTCCAACTCGAGTTGGAAAGGGTGATGAAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-734s1c1
Sequence:CCGGGAACCCTGACAAGGTTGATTTCTCGAGAAATCAACCTTGTCAGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-860s1c1
Sequence:CCGGCCCGATTGCAATACTGAACATCTCGAGATGTTCAGTATTGCAATCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012240.1-87s1c1
Sequence:CCGGCCGTGCTCGAAAGCCTCCATTCTCGAGAATGGAGGCTTTCGAGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-619s21c1
Sequence:CCGGCTCCTGATGGTGACGTCTTTCCTCGAGGAAAGACGTCACCATCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-734s21c1
Sequence:CCGGGAACCCTGACAAGGTTGATTTCTCGAGAAATCAACCTTGTCAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-961s21c1
Sequence:CCGGGCTGACCACAGCCTGATATTCCTCGAGGAATATCAGGCTGTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012240.1-993s21c1
Sequence:CCGGACAGGGACTTTCACTTGAATCCTCGAGGATTCAAGTGAAAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012240.1-798s21c1
Sequence:CCGGGGATCATCCTTGCAGGTATACCTCGAGGTATACCTGCAAGGATGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_485674
VALIDATED
SIRT4 MISSION shRNA Bacterial Glycerol Stock
sirtuin 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000218250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-1705s21c1
Sequence:GTACCGGAGTAAACCACAACTGTCTATGCTCGAGCATAGACAGTTGTGGTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-1410s21c1
Sequence:CCGGTGGAGAGTTGCTGCCTTTAATCTCGAGATTAAAGGCAGCAACTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-517s21c1
Sequence:CCGGTTGACTTTCAGGCCGACAAAGCTCGAGCTTTGTCGGCCTGAAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-299s21c1
Sequence:CCGGGCAGCATATCCGGAACCTTAACTCGAGTTAAGGTTCCGGATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_485674
VALIDATED
SIRT4 MISSION shRNA shRNA Plasmid DNA
sirtuin 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000218250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-1705s21c1
Sequence:GTACCGGAGTAAACCACAACTGTCTATGCTCGAGCATAGACAGTTGTGGTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-1410s21c1
Sequence:CCGGTGGAGAGTTGCTGCCTTTAATCTCGAGATTAAAGGCAGCAACTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-517s21c1
Sequence:CCGGTTGACTTTCAGGCCGACAAAGCTCGAGCTTTGTCGGCCTGAAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-299s21c1
Sequence:CCGGGCAGCATATCCGGAACCTTAACTCGAGTTAAGGTTCCGGATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_485674
VALIDATED
SIRT4 MISSION shRNA Lentiviral Transduction Particles
sirtuin 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000218250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-1705s21c1
Sequence:GTACCGGAGTAAACCACAACTGTCTATGCTCGAGCATAGACAGTTGTGGTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-1410s21c1
Sequence:CCGGTGGAGAGTTGCTGCCTTTAATCTCGAGATTAAAGGCAGCAACTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-517s21c1
Sequence:CCGGTTGACTTTCAGGCCGACAAAGCTCGAGCTTTGTCGGCCTGAAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:XM_485674.5-299s21c1
Sequence:CCGGGCAGCATATCCGGAACCTTAACTCGAGTTAAGGTTCCGGATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks