EMAIL THIS PAGE TO A FRIEND

SIT1

signaling threshold regulating transmembrane adaptor 1

Synonyms: RP11-331F9.5 SIT SIT-R
UniProtKB ID: Q9Y3P8, B2RBP9
Gene ID:
Mouse(54390) suppression inducing transmembrane adaptor 1
Rat(500449) signaling threshold regulating transmembrane adaptor 1
dog(611919) signaling threshold regulating transmembrane adaptor 1
domestic cat(101087016) signaling threshold regulating transmembrane adaptor 1
cow(512027) signaling threshold regulating transmembrane adaptor 1
sheep(101116704) signaling threshold regulating transmembrane adaptor 1
naked mole-rat(101723597) signaling threshold regulating transmembrane adaptor 1
domestic guinea pig(100729363) signaling threshold regulating transmembrane adaptor 1
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU059811 MISSION® esiRNA esiRNA targeting mouse Sit1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014450 Rosetta Predictions human pricing
NM_001024344 Rosetta Predictions rat pricing
NM_019436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087380 predicted 807
2 SASI_Hs01_00087381 predicted 586
3 SASI_Hs01_00087383 predicted 385
4 SASI_Hs01_00087384 predicted 841
5 SASI_Hs01_00087386 predicted 356
6 SASI_Hs02_00345662 predicted 934
7 SASI_Hs02_00345663 predicted 762
8 SASI_Hs01_00087382 predicted 329
9 SASI_Hs01_00087385 predicted 934
10 SASI_Hs01_00087387 predicted 807
11 SASI_Hs01_00087388 predicted 397
12 SASI_Hs01_00087389 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041784 predicted 717
2 SASI_Rn01_00041786 predicted 347
3 SASI_Rn01_00041787 predicted 608
4 SASI_Rn01_00041788 predicted 649
5 SASI_Rn01_00041789 predicted 915
6 SASI_Rn01_00041790 predicted 818
7 SASI_Rn01_00041791 predicted 362
8 SASI_Rn01_00041792 predicted 327
9 SASI_Rn01_00041793 predicted 323
10 SASI_Rn02_00202572 predicted 848
11 SASI_Rn01_00041785 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116114 predicted 600
2 SASI_Mm01_00116115 predicted 902
3 SASI_Mm01_00116116 predicted 344
4 SASI_Mm01_00116117 predicted 946
5 SASI_Mm01_00116118 predicted 740
6 SASI_Mm01_00116119 predicted 802
7 SASI_Mm01_00116120 predicted 761
8 SASI_Mm02_00324383 predicted 308
9 SASI_Mm01_00116121 predicted 744
10 SASI_Mm01_00116122 predicted 320
11 SASI_Mm01_00116123 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014450
SIT1 MISSION shRNA Bacterial Glycerol Stock
signaling threshold regulating transmembrane adaptor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-934s1c1
Sequence:CCGGCCAGGTTCTCACTTCCTTCTTCTCGAGAAGAAGGAAGTGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014450.2-596s1c1
Sequence:CCGGGAGCTCTATGCCTCAGTATGTCTCGAGACATACTGAGGCATAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014450.2-253s1c1
Sequence:CCGGGCTGCTATTTCTCATCTCGCTCTCGAGAGCGAGATGAGAAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-945s1c1
Sequence:CCGGCTTCCTTCTTCTGGAGTTTAACTCGAGTTAAACTCCAGAAGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-813s1c1
Sequence:CCGGGACTTCCTATCTGAGCTTCAACTCGAGTTGAAGCTCAGATAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014450
SIT1 MISSION shRNA shRNA Plasmid DNA
signaling threshold regulating transmembrane adaptor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-934s1c1
Sequence:CCGGCCAGGTTCTCACTTCCTTCTTCTCGAGAAGAAGGAAGTGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014450.2-596s1c1
Sequence:CCGGGAGCTCTATGCCTCAGTATGTCTCGAGACATACTGAGGCATAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014450.2-253s1c1
Sequence:CCGGGCTGCTATTTCTCATCTCGCTCTCGAGAGCGAGATGAGAAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-945s1c1
Sequence:CCGGCTTCCTTCTTCTGGAGTTTAACTCGAGTTAAACTCCAGAAGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-813s1c1
Sequence:CCGGGACTTCCTATCTGAGCTTCAACTCGAGTTGAAGCTCAGATAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014450
SIT1 MISSION shRNA Lentiviral Transduction Particles
signaling threshold regulating transmembrane adaptor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-934s1c1
Sequence:CCGGCCAGGTTCTCACTTCCTTCTTCTCGAGAAGAAGGAAGTGAGAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014450.2-596s1c1
Sequence:CCGGGAGCTCTATGCCTCAGTATGTCTCGAGACATACTGAGGCATAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014450.2-253s1c1
Sequence:CCGGGCTGCTATTTCTCATCTCGCTCTCGAGAGCGAGATGAGAAATAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-945s1c1
Sequence:CCGGCTTCCTTCTTCTGGAGTTTAACTCGAGTTAAACTCCAGAAGAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014450.2-813s1c1
Sequence:CCGGGACTTCCTATCTGAGCTTCAACTCGAGTTGAAGCTCAGATAGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019436
SIT1 MISSION shRNA Bacterial Glycerol Stock
signaling threshold regulating transmembrane adaptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019436.1-903s1c1
Sequence:CCGGCTCACACCTTTCCCTCCATTTCTCGAGAAATGGAGGGAAAGGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-316s1c1
Sequence:CCGGCTGTATGGCAACCTGCACTATCTCGAGATAGTGCAGGTTGCCATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-355s1c1
Sequence:CCGGTCTCAAGAACCAAGGTCAGAACTCGAGTTCTGACCTTGGTTCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-551s1c1
Sequence:CCGGCGGAACTTTATGCCTCCGTGTCTCGAGACACGGAGGCATAAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-598s1c1
Sequence:CCGGTCCTTCCCAGATCAAGCCTATCTCGAGATAGGCTTGATCTGGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019436
SIT1 MISSION shRNA shRNA Plasmid DNA
signaling threshold regulating transmembrane adaptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019436.1-903s1c1
Sequence:CCGGCTCACACCTTTCCCTCCATTTCTCGAGAAATGGAGGGAAAGGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-316s1c1
Sequence:CCGGCTGTATGGCAACCTGCACTATCTCGAGATAGTGCAGGTTGCCATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-355s1c1
Sequence:CCGGTCTCAAGAACCAAGGTCAGAACTCGAGTTCTGACCTTGGTTCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-551s1c1
Sequence:CCGGCGGAACTTTATGCCTCCGTGTCTCGAGACACGGAGGCATAAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-598s1c1
Sequence:CCGGTCCTTCCCAGATCAAGCCTATCTCGAGATAGGCTTGATCTGGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019436
SIT1 MISSION shRNA Lentiviral Transduction Particles
signaling threshold regulating transmembrane adaptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019436.1-903s1c1
Sequence:CCGGCTCACACCTTTCCCTCCATTTCTCGAGAAATGGAGGGAAAGGTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-316s1c1
Sequence:CCGGCTGTATGGCAACCTGCACTATCTCGAGATAGTGCAGGTTGCCATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-355s1c1
Sequence:CCGGTCTCAAGAACCAAGGTCAGAACTCGAGTTCTGACCTTGGTTCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-551s1c1
Sequence:CCGGCGGAACTTTATGCCTCCGTGTCTCGAGACACGGAGGCATAAAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019436.1-598s1c1
Sequence:CCGGTCCTTCCCAGATCAAGCCTATCTCGAGATAGGCTTGATCTGGGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks