EMAIL THIS PAGE TO A FRIEND

SIX2

SIX homeobox 2

UniProtKB ID: Q9NPC8, Q9BXH7
Gene ID:
Human(10736) Summary: This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]
Mouse(20472) sine oculis-related homeobox 2
Rat(366542) SIX homeobox 2
chicken(724086) SIX homeobox 2
dog(481357) SIX homeobox 2
domestic cat(101100295) SIX homeobox 2
naked mole-rat(101698682) SIX homeobox 2
cow(539492) SIX homeobox 2
sheep(101110829) SIX homeobox 2
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016932 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016932 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016932 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031031 MISSION® esiRNA esiRNA human SIX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016932 Rosetta Predictions human pricing
XM_001059855 Rosetta Predictions rat pricing
XM_345630 Rosetta Predictions rat pricing
NM_011380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151769 predicted 538
2 SASI_Hs01_00151770 predicted 871
3 SASI_Hs01_00151771 predicted 882
4 SASI_Hs01_00151772 predicted 1149
5 SASI_Hs01_00151773 predicted 831
6 SASI_Hs01_00151774 predicted 883
7 SASI_Hs01_00151775 predicted 1139
8 SASI_Hs01_00151776 predicted 839
9 SASI_Hs01_00151777 predicted 1532
10 SASI_Hs02_00349925 predicted 1301
11 SASI_Hs01_00151778 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294594 predicted 227
2 SASI_Rn02_00294595 predicted 268
3 SASI_Rn02_00294596 predicted 283
4 SASI_Rn02_00294597 predicted 299
5 SASI_Rn02_00294598 predicted 269
6 SASI_Rn02_00294599 predicted 231
7 SASI_Rn02_00294600 predicted 235
8 SASI_Rn02_00294601 predicted 270
9 SASI_Rn02_00294602 predicted 261
10 SASI_Rn02_00294603 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398573 predicted 366
2 SASI_Rn02_00398574 predicted 559
3 SASI_Rn02_00398575 predicted 259
4 SASI_Rn02_00398576 predicted 376
5 SASI_Rn02_00398577 predicted 607
6 SASI_Rn02_00398578 predicted 625
7 SASI_Rn02_00398579 predicted 564
8 SASI_Rn02_00398580 predicted 417
9 SASI_Rn02_00398581 predicted 584
10 SASI_Rn02_00398582 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101716 predicted 556
2 SASI_Mm01_00101717 predicted 851
3 SASI_Mm01_00101718 predicted 855
4 SASI_Mm01_00101719 predicted 876
5 SASI_Mm02_00320565 predicted 928
6 SASI_Mm01_00101720 predicted 1201
7 SASI_Mm01_00101721 predicted 919
8 SASI_Mm01_00101722 predicted 550
9 SASI_Mm01_00101723 predicted 786
10 SASI_Mm01_00101724 predicted 888
11 SASI_Mm01_00101725 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011380
SIX2 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-421s1c1
Sequence:CCGGCCTCCACAAGAATGAAAGCGTCTCGAGACGCTTTCATTCTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-565s1c1
Sequence:CCGGGCACTACATCGAGGCGGAGAACTCGAGTTCTCCGCCTCGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-931s1c1
Sequence:CCGGGCTAGGCAGTTCCGAGGATGACTCGAGTCATCCTCGGAACTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-861s1c1
Sequence:CCGGACAGCGAGAACTCCAATTCCACTCGAGTGGAATTGGAGTTCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-1064s1c1
Sequence:CCGGCCGAGCGCAGTACCCGTACCACTCGAGTGGTACGGGTACTGCGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011380.2-1664s21c1
Sequence:CCGGTCCTTCTGGTGTCATCTATTTCTCGAGAAATAGATGACACCAGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011380.2-1417s21c1
Sequence:CCGGGAACTAGGCAAGGGAATAAATCTCGAGATTTATTCCCTTGCCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011380.2-485s21c1
Sequence:CCGGCAACTTCCGCGAGCTCTACAACTCGAGTTGTAGAGCTCGCGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011380.2-1136s21c1
Sequence:CCGGCCTGCAGGACTCCATACTCAACTCGAGTTGAGTATGGAGTCCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011380
SIX2 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-421s1c1
Sequence:CCGGCCTCCACAAGAATGAAAGCGTCTCGAGACGCTTTCATTCTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-565s1c1
Sequence:CCGGGCACTACATCGAGGCGGAGAACTCGAGTTCTCCGCCTCGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-931s1c1
Sequence:CCGGGCTAGGCAGTTCCGAGGATGACTCGAGTCATCCTCGGAACTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-861s1c1
Sequence:CCGGACAGCGAGAACTCCAATTCCACTCGAGTGGAATTGGAGTTCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-1064s1c1
Sequence:CCGGCCGAGCGCAGTACCCGTACCACTCGAGTGGTACGGGTACTGCGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011380.2-1664s21c1
Sequence:CCGGTCCTTCTGGTGTCATCTATTTCTCGAGAAATAGATGACACCAGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011380.2-1417s21c1
Sequence:CCGGGAACTAGGCAAGGGAATAAATCTCGAGATTTATTCCCTTGCCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011380.2-485s21c1
Sequence:CCGGCAACTTCCGCGAGCTCTACAACTCGAGTTGTAGAGCTCGCGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011380.2-1136s21c1
Sequence:CCGGCCTGCAGGACTCCATACTCAACTCGAGTTGAGTATGGAGTCCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011380
SIX2 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-421s1c1
Sequence:CCGGCCTCCACAAGAATGAAAGCGTCTCGAGACGCTTTCATTCTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-565s1c1
Sequence:CCGGGCACTACATCGAGGCGGAGAACTCGAGTTCTCCGCCTCGATGTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-931s1c1
Sequence:CCGGGCTAGGCAGTTCCGAGGATGACTCGAGTCATCCTCGGAACTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-861s1c1
Sequence:CCGGACAGCGAGAACTCCAATTCCACTCGAGTGGAATTGGAGTTCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011380.1-1064s1c1
Sequence:CCGGCCGAGCGCAGTACCCGTACCACTCGAGTGGTACGGGTACTGCGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011380.2-1664s21c1
Sequence:CCGGTCCTTCTGGTGTCATCTATTTCTCGAGAAATAGATGACACCAGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011380.2-1417s21c1
Sequence:CCGGGAACTAGGCAAGGGAATAAATCTCGAGATTTATTCCCTTGCCTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011380.2-485s21c1
Sequence:CCGGCAACTTCCGCGAGCTCTACAACTCGAGTTGTAGAGCTCGCGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011380.2-1136s21c1
Sequence:CCGGCCTGCAGGACTCCATACTCAACTCGAGTTGAGTATGGAGTCCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016932
SIX2 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016932.3-1469s1c1
Sequence:CCGGCCTTTCCTCTTCCTTTCCCTTCTCGAGAAGGGAAAGGAAGAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-543s1c1
Sequence:CCGGACACTACATCGAGGCGGAGAACTCGAGTTCTCCGCCTCGATGTAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-870s1c1
Sequence:CCGGCCCGCTGAATGGCAGCGGCAACTCGAGTTGCCGCTGCCATTCAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-394s1c1
Sequence:CCGGGAGCACCTTCACAAGAATGAACTCGAGTTCATTCTTGTGAAGGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-840s1c1
Sequence:CCGGCAACGAGAACTCCAATTCTAACTCGAGTTAGAATTGGAGTTCTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016932.4-953s21c1
Sequence:CCGGGACGCCAGACCACTCATCATCCTCGAGGATGATGAGTGGTCTGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016932.4-1331s21c1
Sequence:CCGGGTTCTTGTTTGGGATTTATTTCTCGAGAAATAAATCCCAAACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016932
SIX2 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016932.3-1469s1c1
Sequence:CCGGCCTTTCCTCTTCCTTTCCCTTCTCGAGAAGGGAAAGGAAGAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-543s1c1
Sequence:CCGGACACTACATCGAGGCGGAGAACTCGAGTTCTCCGCCTCGATGTAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-870s1c1
Sequence:CCGGCCCGCTGAATGGCAGCGGCAACTCGAGTTGCCGCTGCCATTCAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-394s1c1
Sequence:CCGGGAGCACCTTCACAAGAATGAACTCGAGTTCATTCTTGTGAAGGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-840s1c1
Sequence:CCGGCAACGAGAACTCCAATTCTAACTCGAGTTAGAATTGGAGTTCTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016932.4-953s21c1
Sequence:CCGGGACGCCAGACCACTCATCATCCTCGAGGATGATGAGTGGTCTGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016932.4-1331s21c1
Sequence:CCGGGTTCTTGTTTGGGATTTATTTCTCGAGAAATAAATCCCAAACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016932
SIX2 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016932.3-1469s1c1
Sequence:CCGGCCTTTCCTCTTCCTTTCCCTTCTCGAGAAGGGAAAGGAAGAGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-543s1c1
Sequence:CCGGACACTACATCGAGGCGGAGAACTCGAGTTCTCCGCCTCGATGTAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-870s1c1
Sequence:CCGGCCCGCTGAATGGCAGCGGCAACTCGAGTTGCCGCTGCCATTCAGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-394s1c1
Sequence:CCGGGAGCACCTTCACAAGAATGAACTCGAGTTCATTCTTGTGAAGGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016932.3-840s1c1
Sequence:CCGGCAACGAGAACTCCAATTCTAACTCGAGTTAGAATTGGAGTTCTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016932.4-953s21c1
Sequence:CCGGGACGCCAGACCACTCATCATCCTCGAGGATGATGAGTGGTCTGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016932.4-1331s21c1
Sequence:CCGGGTTCTTGTTTGGGATTTATTTCTCGAGAAATAAATCCCAAACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks