EMAIL THIS PAGE TO A FRIEND

SIX3

SIX homeobox 3

Synonyms: HPE2
UniProtKB ID: O95343, D6W5A5, Q53T42
Gene ID:
Human(6496) Summary: This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
Mouse(20473) sine oculis-related homeobox 3
Rat(78974) SIX homeobox 3
chicken(378786) SIX homeobox 3
dog(481356) SIX homeobox 3
cow(616756) SIX homeobox 3
sheep(101111085) SIX homeobox 3
naked mole-rat(101698303) SIX homeobox 3
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409669 Anti-SIX3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412236 ANTI-SIX3 antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412237 ANTI-SIX3 antibody produced in mouse clone 4H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412238 ANTI-SIX3 antibody produced in mouse clone 2B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102158 Anti-SIX3 antibody produced in rabbit affinity isolated antibody human, canine, bovine, mouse, rat
western blot pricing
HPA067988 Anti-SIX3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105314 Anti-SIX3, (C-terminal) antibody produced in rabbit affinity isolated antibody mouse, guinea pig
western blot pricing
WH0006496M1 Monoclonal Anti-SIX3 antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404371 Monoclonal Anti-SIX3, (C-terminal) antibody produced in mouse clone 3F1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005413 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005413 Rosetta Predictions human pricing
NM_023990 Rosetta Predictions rat pricing
NM_011381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236301 predicted 859
2 SASI_Hs01_00236302 predicted 721
3 SASI_Hs01_00236303 predicted 702
4 SASI_Hs01_00236306 predicted 948
5 SASI_Hs01_00236307 predicted 674
6 SASI_Hs01_00236309 predicted 953
7 SASI_Hs02_00339541 predicted 825
8 SASI_Hs02_00339542 predicted 835
9 SASI_Hs02_00339543 predicted 819
10 SASI_Hs02_00339544 predicted 678
11 SASI_Hs01_00236304 predicted 1699
12 SASI_Hs01_00236305 predicted 1705
13 SASI_Hs01_00236308 predicted 1040
14 SASI_Hs01_00236310 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042382 predicted 891
2 SASI_Rn01_00042383 predicted 876
3 SASI_Rn01_00042384 predicted 1121
4 SASI_Rn01_00042385 predicted 1125
5 SASI_Rn01_00042386 predicted 1119
6 SASI_Rn01_00042387 predicted 828
7 SASI_Rn01_00042388 predicted 1006
8 SASI_Rn01_00042390 predicted 833
9 SASI_Rn01_00042391 predicted 849
10 SASI_Rn02_00263824 predicted 938
11 SASI_Rn01_00042389 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042510 predicted 918
2 SASI_Mm01_00042511 predicted 908
3 SASI_Mm01_00042512 predicted 1148
4 SASI_Mm01_00042513 predicted 1153
5 SASI_Mm01_00042515 predicted 859
6 SASI_Mm01_00042516 predicted 836
7 SASI_Mm01_00042517 predicted 833
8 SASI_Mm01_00042518 predicted 870
9 SASI_Mm01_00042519 predicted 1033
10 SASI_Mm02_00320566 predicted 879
11 SASI_Mm01_00042514 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005413
SIX3 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005413.3-580s21c1
Sequence:CCGGATCAACAAACACGAGTCGATCCTCGAGGATCGACTCGTGTTTGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005413.3-253s21c1
Sequence:CCGGTTGCCAAACTTCGCCGATTCTCTCGAGAGAATCGGCGAAGTTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005413.3-1648s21c1
Sequence:CCGGTGATTTAAAGAGTCGACTATACTCGAGTATAGTCGACTCTTTAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005413.1-1768s1c1
Sequence:CCGGCCCACCTGCATGACGATTTATCTCGAGATAAATCGTCATGCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-1129s1c1
Sequence:CCGGAGTAGGCAACTGGTTTAAGAACTCGAGTTCTTAAACCAGTTGCCTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-1359s1c1
Sequence:CCGGGCGACTCGGAATGTGATGTATCTCGAGATACATCACATTCCGAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-456s1c1
Sequence:CCGGGCTCCATACTTCTGGCGAGTACTCGAGTACTCGCCAGAAGTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-601s1c1
Sequence:CCGGCCCGGAAGAGTTGTCCATGTTCTCGAGAACATGGACAACTCTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005413
SIX3 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005413.3-580s21c1
Sequence:CCGGATCAACAAACACGAGTCGATCCTCGAGGATCGACTCGTGTTTGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005413.3-253s21c1
Sequence:CCGGTTGCCAAACTTCGCCGATTCTCTCGAGAGAATCGGCGAAGTTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005413.3-1648s21c1
Sequence:CCGGTGATTTAAAGAGTCGACTATACTCGAGTATAGTCGACTCTTTAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005413.1-1768s1c1
Sequence:CCGGCCCACCTGCATGACGATTTATCTCGAGATAAATCGTCATGCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-1129s1c1
Sequence:CCGGAGTAGGCAACTGGTTTAAGAACTCGAGTTCTTAAACCAGTTGCCTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-1359s1c1
Sequence:CCGGGCGACTCGGAATGTGATGTATCTCGAGATACATCACATTCCGAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-456s1c1
Sequence:CCGGGCTCCATACTTCTGGCGAGTACTCGAGTACTCGCCAGAAGTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-601s1c1
Sequence:CCGGCCCGGAAGAGTTGTCCATGTTCTCGAGAACATGGACAACTCTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005413
SIX3 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005413.3-580s21c1
Sequence:CCGGATCAACAAACACGAGTCGATCCTCGAGGATCGACTCGTGTTTGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005413.3-253s21c1
Sequence:CCGGTTGCCAAACTTCGCCGATTCTCTCGAGAGAATCGGCGAAGTTTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005413.3-1648s21c1
Sequence:CCGGTGATTTAAAGAGTCGACTATACTCGAGTATAGTCGACTCTTTAAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005413.1-1768s1c1
Sequence:CCGGCCCACCTGCATGACGATTTATCTCGAGATAAATCGTCATGCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-1129s1c1
Sequence:CCGGAGTAGGCAACTGGTTTAAGAACTCGAGTTCTTAAACCAGTTGCCTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-1359s1c1
Sequence:CCGGGCGACTCGGAATGTGATGTATCTCGAGATACATCACATTCCGAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-456s1c1
Sequence:CCGGGCTCCATACTTCTGGCGAGTACTCGAGTACTCGCCAGAAGTATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005413.1-601s1c1
Sequence:CCGGCCCGGAAGAGTTGTCCATGTTCTCGAGAACATGGACAACTCTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011381
SIX3 MISSION shRNA Bacterial Glycerol Stock
SIX homeobox 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011381.1-1572s1c1
Sequence:CCGGGCTGATCCAGTTCTGGAGATACTCGAGTATCTCCAGAACTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-1288s1c1
Sequence:CCGGCGAGCAGAAGACCCATTGCTTCTCGAGAAGCAATGGGTCTTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-1111s1c1
Sequence:CCGGCCTGTACCACATCCTGGAGAACTCGAGTTCTCCAGGATGTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-741s1c1
Sequence:CCGGGCTCCCTACTTCTGGCGAGTACTCGAGTACTCGCCAGAAGTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-703s1c1
Sequence:CCGGCCACTTCTTGTTGCCAAACTTCTCGAGAAGTTTGGCAACAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011381
SIX3 MISSION shRNA shRNA Plasmid DNA
SIX homeobox 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011381.1-1572s1c1
Sequence:CCGGGCTGATCCAGTTCTGGAGATACTCGAGTATCTCCAGAACTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-1288s1c1
Sequence:CCGGCGAGCAGAAGACCCATTGCTTCTCGAGAAGCAATGGGTCTTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-1111s1c1
Sequence:CCGGCCTGTACCACATCCTGGAGAACTCGAGTTCTCCAGGATGTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-741s1c1
Sequence:CCGGGCTCCCTACTTCTGGCGAGTACTCGAGTACTCGCCAGAAGTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-703s1c1
Sequence:CCGGCCACTTCTTGTTGCCAAACTTCTCGAGAAGTTTGGCAACAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011381
SIX3 MISSION shRNA Lentiviral Transduction Particles
SIX homeobox 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011381.1-1572s1c1
Sequence:CCGGGCTGATCCAGTTCTGGAGATACTCGAGTATCTCCAGAACTGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-1288s1c1
Sequence:CCGGCGAGCAGAAGACCCATTGCTTCTCGAGAAGCAATGGGTCTTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-1111s1c1
Sequence:CCGGCCTGTACCACATCCTGGAGAACTCGAGTTCTCCAGGATGTGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-741s1c1
Sequence:CCGGGCTCCCTACTTCTGGCGAGTACTCGAGTACTCGCCAGAAGTAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011381.1-703s1c1
Sequence:CCGGCCACTTCTTGTTGCCAAACTTCTCGAGAAGTTTGGCAACAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks