EMAIL THIS PAGE TO A FRIEND

SLC10A3

solute carrier family 10, member 3

Synonyms: DXS253E P3
UniProtKB ID: P09131, Q5HY79, Q9BSL2
Gene ID:
Human(8273) Summary: This gene maps to a GC-rich region of the X chromosome and was identified by its proximity to a CpG island. It is thought to be a housekeeping gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2008]
Mouse(214601) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
Rat(501665) solute carrier family 10, member 3
naked mole-rat(101710250) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
domestic guinea pig(100733179) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
cow(504534) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
sheep(101108194) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
Zebrafish(406519) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
Horse(100058388) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
domestic cat(101085188) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
dog(481087) solute carrier family 10 (sodium/bile acid cotransporter family), member 3
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019848 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019848 Rosetta Predictions human pricing
NM_001024368 Rosetta Predictions rat pricing
NM_145406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176140 predicted 1633
2 SASI_Hs01_00176141 predicted 1078
3 SASI_Hs01_00176142 predicted 1188
4 SASI_Hs01_00176143 predicted 1789
5 SASI_Hs01_00176144 predicted 1103
6 SASI_Hs01_00176145 predicted 1589
7 SASI_Hs01_00176146 predicted 823
8 SASI_Hs01_00176147 predicted 970
9 SASI_Hs01_00176148 predicted 677
10 SASI_Hs01_00176149 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108206 predicted 816
2 SASI_Rn01_00108207 predicted 473
3 SASI_Rn01_00108208 predicted 403
4 SASI_Rn01_00108209 predicted 793
5 SASI_Rn01_00108210 predicted 716
6 SASI_Rn01_00108211 predicted 848
7 SASI_Rn01_00108212 predicted 838
8 SASI_Rn01_00108213 predicted 1225
9 SASI_Rn02_00202600 predicted 549
10 SASI_Rn01_00108215 predicted 486
11 SASI_Rn01_00108214 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069024 predicted 810
2 SASI_Mm01_00069025 predicted 437
3 SASI_Mm01_00069027 predicted 882
4 SASI_Mm01_00069029 predicted 480
5 SASI_Mm01_00069030 predicted 1299
6 SASI_Mm02_00340740 predicted 495
7 SASI_Mm01_00069031 predicted 1115
8 SASI_Mm01_00069032 predicted 1638
9 SASI_Mm01_00069033 predicted 1651
10 SASI_Mm02_00340741 predicted 575
11 SASI_Mm01_00069026 predicted 1043
12 SASI_Mm01_00069028 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019848
SLC10A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 10, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1083s1c1
Sequence:CCGGGCCTCTTATCTTTGTCAACAACTCGAGTTGTTGACAAAGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-840s1c1
Sequence:CCGGCATCAAGAACGTGAGTGCTATCTCGAGATAGCACTCACGTTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-682s1c1
Sequence:CCGGCGCTACTTGAGCATTGGAGATCTCGAGATCTCCAATGCTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1893s1c1
Sequence:CCGGCTTCATCTACAGCAGCCTGTTCTCGAGAACAGGCTGCTGTAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1346s1c1
Sequence:CCGGTCTCCATGACTTTCCTCTCTACTCGAGTAGAGAGGAAAGTCATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019848.3-1205s21c1
Sequence:CCGGGTCATGCCCTTGTACGCTTTCCTCGAGGAAAGCGTACAAGGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019848.3-1978s21c1
Sequence:CCGGCCAAAGTTCTCATGCACTATGCTCGAGCATAGTGCATGAGAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019848.3-745s21c1
Sequence:CCGGTGAGGGCATCATCGTGATCTCCTCGAGGAGATCACGATGATGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019848
SLC10A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 10, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1083s1c1
Sequence:CCGGGCCTCTTATCTTTGTCAACAACTCGAGTTGTTGACAAAGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-840s1c1
Sequence:CCGGCATCAAGAACGTGAGTGCTATCTCGAGATAGCACTCACGTTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-682s1c1
Sequence:CCGGCGCTACTTGAGCATTGGAGATCTCGAGATCTCCAATGCTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1893s1c1
Sequence:CCGGCTTCATCTACAGCAGCCTGTTCTCGAGAACAGGCTGCTGTAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1346s1c1
Sequence:CCGGTCTCCATGACTTTCCTCTCTACTCGAGTAGAGAGGAAAGTCATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019848.3-1205s21c1
Sequence:CCGGGTCATGCCCTTGTACGCTTTCCTCGAGGAAAGCGTACAAGGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019848.3-1978s21c1
Sequence:CCGGCCAAAGTTCTCATGCACTATGCTCGAGCATAGTGCATGAGAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019848.3-745s21c1
Sequence:CCGGTGAGGGCATCATCGTGATCTCCTCGAGGAGATCACGATGATGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019848
SLC10A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 10, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1083s1c1
Sequence:CCGGGCCTCTTATCTTTGTCAACAACTCGAGTTGTTGACAAAGATAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-840s1c1
Sequence:CCGGCATCAAGAACGTGAGTGCTATCTCGAGATAGCACTCACGTTCTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-682s1c1
Sequence:CCGGCGCTACTTGAGCATTGGAGATCTCGAGATCTCCAATGCTCAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1893s1c1
Sequence:CCGGCTTCATCTACAGCAGCCTGTTCTCGAGAACAGGCTGCTGTAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019848.2-1346s1c1
Sequence:CCGGTCTCCATGACTTTCCTCTCTACTCGAGTAGAGAGGAAAGTCATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019848.3-1205s21c1
Sequence:CCGGGTCATGCCCTTGTACGCTTTCCTCGAGGAAAGCGTACAAGGGCATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419473    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019848.3-1978s21c1
Sequence:CCGGCCAAAGTTCTCATGCACTATGCTCGAGCATAGTGCATGAGAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019848.3-745s21c1
Sequence:CCGGTGAGGGCATCATCGTGATCTCCTCGAGGAGATCACGATGATGCCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145406
VALIDATED
SLC10A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 10, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145406.1-1032s1c1
Sequence:CCGGGCCTCATCATTACCTGCTCATCTCGAGATGAGCAGGTAATGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-474s1c1
Sequence:CCGGGCTCAGTGACAGAATTTGATTCTCGAGAATCAAATTCTGTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-1213s1c1
Sequence:CCGGCGTGCCCATCTCCAAGATATTCTCGAGAATATCTTGGAGATGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145406.1-438s1c1
Sequence:CCGGGCCACACAAGTGGTCACTATTCTCGAGAATAGTGACCACTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-1746s1c1
Sequence:CCGGCCACAGTTCTTGTGTACCGTACTCGAGTACGGTACACAAGAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145406.1-1267s21c1
Sequence:CCGGAGCGGGTGTGGTGATCAAATCCTCGAGGATTTGATCACCACACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-439s21c1
Sequence:CCGGCCACACAAGTGGTCACTATTTCTCGAGAAATAGTGACCACTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-596s21c1
Sequence:CCGGACAGAGGTGCTGACCATTAAGCTCGAGCTTAATGGTCAGCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-1759s21c1
Sequence:CCGGGTACCGTACCAAAGGCCTTTACTCGAGTAAAGGCCTTTGGTACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145406.1-501s21c1
Sequence:CCGGAGAAGAGTGAGGGTATCATTGCTCGAGCAATGATACCCTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145406
VALIDATED
SLC10A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 10, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145406.1-1032s1c1
Sequence:CCGGGCCTCATCATTACCTGCTCATCTCGAGATGAGCAGGTAATGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-474s1c1
Sequence:CCGGGCTCAGTGACAGAATTTGATTCTCGAGAATCAAATTCTGTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-1213s1c1
Sequence:CCGGCGTGCCCATCTCCAAGATATTCTCGAGAATATCTTGGAGATGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145406.1-438s1c1
Sequence:CCGGGCCACACAAGTGGTCACTATTCTCGAGAATAGTGACCACTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-1746s1c1
Sequence:CCGGCCACAGTTCTTGTGTACCGTACTCGAGTACGGTACACAAGAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145406.1-1267s21c1
Sequence:CCGGAGCGGGTGTGGTGATCAAATCCTCGAGGATTTGATCACCACACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-439s21c1
Sequence:CCGGCCACACAAGTGGTCACTATTTCTCGAGAAATAGTGACCACTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-596s21c1
Sequence:CCGGACAGAGGTGCTGACCATTAAGCTCGAGCTTAATGGTCAGCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-1759s21c1
Sequence:CCGGGTACCGTACCAAAGGCCTTTACTCGAGTAAAGGCCTTTGGTACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145406.1-501s21c1
Sequence:CCGGAGAAGAGTGAGGGTATCATTGCTCGAGCAATGATACCCTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145406
VALIDATED
SLC10A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 10, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145406.1-1032s1c1
Sequence:CCGGGCCTCATCATTACCTGCTCATCTCGAGATGAGCAGGTAATGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-474s1c1
Sequence:CCGGGCTCAGTGACAGAATTTGATTCTCGAGAATCAAATTCTGTCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-1213s1c1
Sequence:CCGGCGTGCCCATCTCCAAGATATTCTCGAGAATATCTTGGAGATGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145406.1-438s1c1
Sequence:CCGGGCCACACAAGTGGTCACTATTCTCGAGAATAGTGACCACTTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145406.1-1746s1c1
Sequence:CCGGCCACAGTTCTTGTGTACCGTACTCGAGTACGGTACACAAGAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145406.1-1267s21c1
Sequence:CCGGAGCGGGTGTGGTGATCAAATCCTCGAGGATTTGATCACCACACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-439s21c1
Sequence:CCGGCCACACAAGTGGTCACTATTTCTCGAGAAATAGTGACCACTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-596s21c1
Sequence:CCGGACAGAGGTGCTGACCATTAAGCTCGAGCTTAATGGTCAGCACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145406.1-1759s21c1
Sequence:CCGGGTACCGTACCAAAGGCCTTTACTCGAGTAAAGGCCTTTGGTACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145406.1-501s21c1
Sequence:CCGGAGAAGAGTGAGGGTATCATTGCTCGAGCAATGATACCCTCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks