EMAIL THIS PAGE TO A FRIEND

SLC11A2

solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2

Synonyms: DCT1 DMT1 NRAMP2
Gene ID:
Human(4891) Summary: This gene encodes a member of the solute carrier family 11 protein family. The product of this gene transports divalent metals and is involved in iron absorption. Mutations in this gene are associated with hypochromic microcytic anemia with iron overload. A related solute carrier family 11 protein gene is located on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2010]
Mouse(18174) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Rat(25715) solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
cow(521189) solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
naked mole-rat(101723788) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
domestic guinea pig(100718794) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Zebrafish(678623) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
chicken(751817) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Horse(100052385) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
domestic cat(101089199) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
dog(486543) solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000617 Rosetta Predictions human pricing
NM_013173 Rosetta Predictions rat pricing
NM_008732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013104 predicted 597
2 SASI_Hs01_00013105 predicted 1518
3 SASI_Hs01_00013106 predicted 1016
4 SASI_Hs01_00013107 predicted 347
5 SASI_Hs01_00013108 predicted 219
6 SASI_Hs01_00013109 predicted 1250
7 SASI_Hs01_00013110 predicted 1416
8 SASI_Hs01_00013111 predicted 897
9 SASI_Hs01_00013113 predicted 1724
10 SASI_Hs02_00302943 predicted 294
11 SASI_Hs01_00013112 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013173 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052409 predicted 1646
2 SASI_Rn01_00052410 predicted 1502
3 SASI_Rn01_00052412 predicted 923
4 SASI_Rn01_00052413 predicted 936
5 SASI_Rn01_00052414 predicted 762
6 SASI_Rn01_00052415 predicted 560
7 SASI_Rn01_00052416 predicted 1272
8 SASI_Rn02_00260996 predicted 974
9 SASI_Rn01_00052418 predicted 304
10 SASI_Rn02_00260997 predicted 642
11 SASI_Rn01_00052411 predicted 1055
12 SASI_Rn01_00052417 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075853 predicted 1242
2 SASI_Mm01_00075854 predicted 448
3 SASI_Mm01_00075855 predicted 850
4 SASI_Mm01_00075856 predicted 523
5 SASI_Mm01_00075857 predicted 1608
6 SASI_Mm01_00075858 predicted 1595
7 SASI_Mm01_00075859 predicted 998
8 SASI_Mm01_00075860 predicted 1230
9 SASI_Mm01_00075861 predicted 1643
10 SASI_Mm02_00314584 predicted 1030
11 SASI_Mm01_00075862 predicted 732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008732
VALIDATED
SLC11A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-792s21c1
Sequence:CCGGCACGTTTGGATATGAGTACATCTCGAGATGTACTCATATCCAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-969s21c1
Sequence:CCGGACAGGTGAATCGGGCCAATAACTCGAGTTATTGGCCCGATTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008732.2-2072s21c1
Sequence:CCGGGGGTTTAAAGTGTATCGATATCTCGAGATATCGATACACTTTAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-1637s21c1
Sequence:CCGGTAGGGCATGTGGCACTCTATGCTCGAGCATAGAGTGCCACATGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-1067s21c1
Sequence:CCGGTCTTTGTCGTGTCCGTCTTTGCTCGAGCAAAGACGGACACGACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-2040s1c1
Sequence:CCGGCGTGCCAGTTTGGGTAAGATTCTCGAGAATCTTACCCAAACTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-720s1c1
Sequence:CCGGCACGTTTGGATATGAGTACATCTCGAGATGTACTCATATCCAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008732.1-291s1c1
Sequence:CCGGCTTTCTTATGAGCATTGCCTACTCGAGTAGGCAATGCTCATAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-1713s1c1
Sequence:CCGGGCCTGAACTCTATCTTCTGAACTCGAGTTCAGAAGATAGAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008732.1-722s1c1
Sequence:CCGGCGTTTGGATATGAGTACATTACTCGAGTAATGTACTCATATCCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008732
VALIDATED
SLC11A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-792s21c1
Sequence:CCGGCACGTTTGGATATGAGTACATCTCGAGATGTACTCATATCCAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-969s21c1
Sequence:CCGGACAGGTGAATCGGGCCAATAACTCGAGTTATTGGCCCGATTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008732.2-2072s21c1
Sequence:CCGGGGGTTTAAAGTGTATCGATATCTCGAGATATCGATACACTTTAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-1637s21c1
Sequence:CCGGTAGGGCATGTGGCACTCTATGCTCGAGCATAGAGTGCCACATGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-1067s21c1
Sequence:CCGGTCTTTGTCGTGTCCGTCTTTGCTCGAGCAAAGACGGACACGACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-2040s1c1
Sequence:CCGGCGTGCCAGTTTGGGTAAGATTCTCGAGAATCTTACCCAAACTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-720s1c1
Sequence:CCGGCACGTTTGGATATGAGTACATCTCGAGATGTACTCATATCCAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008732.1-291s1c1
Sequence:CCGGCTTTCTTATGAGCATTGCCTACTCGAGTAGGCAATGCTCATAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-1713s1c1
Sequence:CCGGGCCTGAACTCTATCTTCTGAACTCGAGTTCAGAAGATAGAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008732.1-722s1c1
Sequence:CCGGCGTTTGGATATGAGTACATTACTCGAGTAATGTACTCATATCCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008732
VALIDATED
SLC11A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-792s21c1
Sequence:CCGGCACGTTTGGATATGAGTACATCTCGAGATGTACTCATATCCAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-969s21c1
Sequence:CCGGACAGGTGAATCGGGCCAATAACTCGAGTTATTGGCCCGATTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008732.2-2072s21c1
Sequence:CCGGGGGTTTAAAGTGTATCGATATCTCGAGATATCGATACACTTTAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-1637s21c1
Sequence:CCGGTAGGGCATGTGGCACTCTATGCTCGAGCATAGAGTGCCACATGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008732.2-1067s21c1
Sequence:CCGGTCTTTGTCGTGTCCGTCTTTGCTCGAGCAAAGACGGACACGACAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-2040s1c1
Sequence:CCGGCGTGCCAGTTTGGGTAAGATTCTCGAGAATCTTACCCAAACTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-720s1c1
Sequence:CCGGCACGTTTGGATATGAGTACATCTCGAGATGTACTCATATCCAAACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008732.1-291s1c1
Sequence:CCGGCTTTCTTATGAGCATTGCCTACTCGAGTAGGCAATGCTCATAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008732.1-1713s1c1
Sequence:CCGGGCCTGAACTCTATCTTCTGAACTCGAGTTCAGAAGATAGAGTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008732.1-722s1c1
Sequence:CCGGCGTTTGGATATGAGTACATTACTCGAGTAATGTACTCATATCCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000617
SLC11A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000043248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-599s1c1
Sequence:CCGGGCTATCAATCTTCTGTCTGTACTCGAGTACAGACAGAAGATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-1711s1c1
Sequence:CCGGGCATACGGTAAGCATCTCTAACTCGAGTTAGAGATGCTTACCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-285s1c1
Sequence:CCGGGCTTTCGTAAACTCTGGGCTTCTCGAGAAGCCCAGAGTTTACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-1245s1c1
Sequence:CCGGCCACCATGACAGGAACCTATTCTCGAGAATAGGTTCCTGTCATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000617
SLC11A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000043248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-599s1c1
Sequence:CCGGGCTATCAATCTTCTGTCTGTACTCGAGTACAGACAGAAGATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-1711s1c1
Sequence:CCGGGCATACGGTAAGCATCTCTAACTCGAGTTAGAGATGCTTACCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-285s1c1
Sequence:CCGGGCTTTCGTAAACTCTGGGCTTCTCGAGAAGCCCAGAGTTTACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-1245s1c1
Sequence:CCGGCCACCATGACAGGAACCTATTCTCGAGAATAGGTTCCTGTCATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000617
SLC11A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 11 (proton-coupled divalent metal ion transporter), member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000043248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-599s1c1
Sequence:CCGGGCTATCAATCTTCTGTCTGTACTCGAGTACAGACAGAAGATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-1711s1c1
Sequence:CCGGGCATACGGTAAGCATCTCTAACTCGAGTTAGAGATGCTTACCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-285s1c1
Sequence:CCGGGCTTTCGTAAACTCTGGGCTTCTCGAGAAGCCCAGAGTTTACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000617.1-1245s1c1
Sequence:CCGGCCACCATGACAGGAACCTATTCTCGAGAATAGGTTCCTGTCATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks