EMAIL THIS PAGE TO A FRIEND

SLC12A4

solute carrier family 12 (potassium/chloride transporter), member 4

Synonyms: KCC1
Gene ID:
Human(6560) Summary: This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
Mouse(20498) solute carrier family 12, member 4
Rat(29501) solute carrier family 12 (potassium/chloride transporter), member 4
Zebrafish(562826) solute carrier family 12 (potassium/chloride transporters), member 4
chicken(415715) solute carrier family 12 (potassium/chloride transporters), member 4
domestic cat(101082453) solute carrier family 12 (potassium/chloride transporters), member 4
dog(479679) solute carrier family 12 (potassium/chloride transporters), member 4
cow(533876) solute carrier family 12 (potassium/chloride transporters), member 4
naked mole-rat(101699423) solute carrier family 12 (potassium/chloride transporters), member 4
domestic guinea pig(100729548) solute carrier family 12 (potassium/chloride transporters), member 4
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005072 Rosetta Predictions human pricing
NM_019229 Rosetta Predictions rat pricing
NM_009195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193478 predicted 1338
2 SASI_Hs01_00193479 predicted 3301
3 SASI_Hs01_00193480 predicted 1804
4 SASI_Hs01_00193482 predicted 2425
5 SASI_Hs02_00338905 predicted 3306
6 SASI_Hs01_00193483 predicted 1302
7 SASI_Hs01_00193484 predicted 2542
8 SASI_Hs01_00193485 predicted 1021
9 SASI_Hs01_00193486 predicted 2753
10 SASI_Hs01_00193487 predicted 800
11 SASI_Hs01_00193481 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063989 predicted 3232
2 SASI_Rn01_00063990 predicted 2020
3 SASI_Rn01_00063991 predicted 969
4 SASI_Rn01_00063992 predicted 1031
5 SASI_Rn01_00063993 predicted 3020
6 SASI_Rn01_00063994 predicted 1187
7 SASI_Rn01_00063995 predicted 2950
8 SASI_Rn01_00063996 predicted 2198
9 SASI_Rn01_00063997 predicted 1364
10 SASI_Rn01_00063998 predicted 2790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107868 predicted 2748
2 SASI_Mm01_00107869 predicted 912
3 SASI_Mm01_00107870 predicted 1625
4 SASI_Mm01_00107872 predicted 1036
5 SASI_Mm01_00107873 predicted 2795
6 SASI_Mm01_00107874 predicted 949
7 SASI_Mm02_00315571 predicted 1824
8 SASI_Mm01_00107875 predicted 2763
9 SASI_Mm01_00107876 predicted 775
10 SASI_Mm01_00107877 predicted 2749
11 SASI_Mm01_00107871 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009195
VALIDATED
SLC12A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12 (potassium/chloride transporter), member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-2415s21c1
Sequence:CCGGACGTGCCTGGAAGACCTTTATCTCGAGATAAAGGTCTTCCAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009195.2-3500s21c1
Sequence:CCGGGTGAGGGTTGATACGGGATTTCTCGAGAAATCCCGTATCAACCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-118s21c1
Sequence:CCGGCAGGGTAACCACAGAGAGAATCTCGAGATTCTCTCTGTGGTTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-665s21c1
Sequence:CCGGAGATCTTGCTGACCTACATTGCTCGAGCAATGTAGGTCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-249s21c1
Sequence:CCGGGGGCAAGCTTGTCAGCTATACCTCGAGGTATAGCTGACAAGCTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009195.1-2238s1c1
Sequence:CCGGGCAGACCATCAAGAACATGATCTCGAGATCATGTTCTTGATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-3155s1c1
Sequence:CCGGGCGACGAGAACTACATGGAATCTCGAGATTCCATGTAGTTCTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-118s1c1
Sequence:CCGGCAGGGTAACCACAGAGAGAATCTCGAGATTCTCTCTGTGGTTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009195.1-741s1c1
Sequence:CCGGCTTGAATAACATGAGAGTGTACTCGAGTACACTCTCATGTTATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-2416s1c1
Sequence:CCGGCGTGCCTGGAAGACCTTTATTCTCGAGAATAAAGGTCTTCCAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009195
VALIDATED
SLC12A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12 (potassium/chloride transporter), member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-2415s21c1
Sequence:CCGGACGTGCCTGGAAGACCTTTATCTCGAGATAAAGGTCTTCCAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009195.2-3500s21c1
Sequence:CCGGGTGAGGGTTGATACGGGATTTCTCGAGAAATCCCGTATCAACCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-118s21c1
Sequence:CCGGCAGGGTAACCACAGAGAGAATCTCGAGATTCTCTCTGTGGTTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-665s21c1
Sequence:CCGGAGATCTTGCTGACCTACATTGCTCGAGCAATGTAGGTCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-249s21c1
Sequence:CCGGGGGCAAGCTTGTCAGCTATACCTCGAGGTATAGCTGACAAGCTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009195.1-2238s1c1
Sequence:CCGGGCAGACCATCAAGAACATGATCTCGAGATCATGTTCTTGATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-3155s1c1
Sequence:CCGGGCGACGAGAACTACATGGAATCTCGAGATTCCATGTAGTTCTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-118s1c1
Sequence:CCGGCAGGGTAACCACAGAGAGAATCTCGAGATTCTCTCTGTGGTTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009195.1-741s1c1
Sequence:CCGGCTTGAATAACATGAGAGTGTACTCGAGTACACTCTCATGTTATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-2416s1c1
Sequence:CCGGCGTGCCTGGAAGACCTTTATTCTCGAGAATAAAGGTCTTCCAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009195
VALIDATED
SLC12A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12 (potassium/chloride transporter), member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-2415s21c1
Sequence:CCGGACGTGCCTGGAAGACCTTTATCTCGAGATAAAGGTCTTCCAGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009195.2-3500s21c1
Sequence:CCGGGTGAGGGTTGATACGGGATTTCTCGAGAAATCCCGTATCAACCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-118s21c1
Sequence:CCGGCAGGGTAACCACAGAGAGAATCTCGAGATTCTCTCTGTGGTTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-665s21c1
Sequence:CCGGAGATCTTGCTGACCTACATTGCTCGAGCAATGTAGGTCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009195.2-249s21c1
Sequence:CCGGGGGCAAGCTTGTCAGCTATACCTCGAGGTATAGCTGACAAGCTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009195.1-2238s1c1
Sequence:CCGGGCAGACCATCAAGAACATGATCTCGAGATCATGTTCTTGATGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-3155s1c1
Sequence:CCGGGCGACGAGAACTACATGGAATCTCGAGATTCCATGTAGTTCTCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-118s1c1
Sequence:CCGGCAGGGTAACCACAGAGAGAATCTCGAGATTCTCTCTGTGGTTACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009195.1-741s1c1
Sequence:CCGGCTTGAATAACATGAGAGTGTACTCGAGTACACTCTCATGTTATTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009195.1-2416s1c1
Sequence:CCGGCGTGCCTGGAAGACCTTTATTCTCGAGAATAAAGGTCTTCCAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005072
VALIDATED
SLC12A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12 (potassium/chloride transporter), member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-3638s21c1
Sequence:CCGGAGCGCTATTTATTGCATATTTCTCGAGAAATATGCAATAAATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005072.3-1430s21c1
Sequence:CCGGGGACCATTCTGGCCATCATTACTCGAGTAATGATGGCCAGAATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005072.3-800s21c1
Sequence:CCGGCGAATGCCACTTTGAACAATACTCGAGTATTGTTCAAAGTGGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-734s21c1
Sequence:CCGGAGATCTTGCTGACCTACATTGCTCGAGCAATGTAGGTCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-236s21c1
Sequence:CCGGCCAGAGGAATTGACTACTATGCTCGAGCATAGTAGTCAATTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-1353s1c1
Sequence:CCGGCCCTTCTGTAACAGGCATCATCTCGAGATGATGCCTGTTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-295s1c1
Sequence:CCGGCGCCCAAAGGTATCGTCTCTTCTCGAGAAGAGACGATACCTTTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005072.3-2004s1c1
Sequence:CCGGCGGCATGATCTACAAATACATCTCGAGATGTATTTGTAGATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-1023s1c1
Sequence:CCGGCCAGTTTGACATCTGTGCCAACTCGAGTTGGCACAGATGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-3089s1c1
Sequence:CCGGTGCACATTAAGCCGGACCAATCTCGAGATTGGTCCGGCTTAATGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005072
VALIDATED
SLC12A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12 (potassium/chloride transporter), member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-3638s21c1
Sequence:CCGGAGCGCTATTTATTGCATATTTCTCGAGAAATATGCAATAAATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005072.3-1430s21c1
Sequence:CCGGGGACCATTCTGGCCATCATTACTCGAGTAATGATGGCCAGAATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005072.3-800s21c1
Sequence:CCGGCGAATGCCACTTTGAACAATACTCGAGTATTGTTCAAAGTGGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-734s21c1
Sequence:CCGGAGATCTTGCTGACCTACATTGCTCGAGCAATGTAGGTCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-236s21c1
Sequence:CCGGCCAGAGGAATTGACTACTATGCTCGAGCATAGTAGTCAATTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-1353s1c1
Sequence:CCGGCCCTTCTGTAACAGGCATCATCTCGAGATGATGCCTGTTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-295s1c1
Sequence:CCGGCGCCCAAAGGTATCGTCTCTTCTCGAGAAGAGACGATACCTTTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005072.3-2004s1c1
Sequence:CCGGCGGCATGATCTACAAATACATCTCGAGATGTATTTGTAGATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-1023s1c1
Sequence:CCGGCCAGTTTGACATCTGTGCCAACTCGAGTTGGCACAGATGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-3089s1c1
Sequence:CCGGTGCACATTAAGCCGGACCAATCTCGAGATTGGTCCGGCTTAATGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005072
VALIDATED
SLC12A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12 (potassium/chloride transporter), member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-3638s21c1
Sequence:CCGGAGCGCTATTTATTGCATATTTCTCGAGAAATATGCAATAAATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005072.3-1430s21c1
Sequence:CCGGGGACCATTCTGGCCATCATTACTCGAGTAATGATGGCCAGAATGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005072.3-800s21c1
Sequence:CCGGCGAATGCCACTTTGAACAATACTCGAGTATTGTTCAAAGTGGCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-734s21c1
Sequence:CCGGAGATCTTGCTGACCTACATTGCTCGAGCAATGTAGGTCAGCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005072.3-236s21c1
Sequence:CCGGCCAGAGGAATTGACTACTATGCTCGAGCATAGTAGTCAATTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-1353s1c1
Sequence:CCGGCCCTTCTGTAACAGGCATCATCTCGAGATGATGCCTGTTACAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-295s1c1
Sequence:CCGGCGCCCAAAGGTATCGTCTCTTCTCGAGAAGAGACGATACCTTTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005072.3-2004s1c1
Sequence:CCGGCGGCATGATCTACAAATACATCTCGAGATGTATTTGTAGATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-1023s1c1
Sequence:CCGGCCAGTTTGACATCTGTGCCAACTCGAGTTGGCACAGATGTCAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005072.3-3089s1c1
Sequence:CCGGTGCACATTAAGCCGGACCAATCTCGAGATTGGTCCGGCTTAATGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks