EMAIL THIS PAGE TO A FRIEND

SLC12A5

solute carrier family 12 (potassium/chloride transporter), member 5

Synonyms: KCC2
UniProtKB ID: Q9H2X9, A2RTX2, Q5VZ41, Q9H4Z0, Q9ULP4
Gene ID:
Human(57468) Summary: K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
Mouse(57138) solute carrier family 12, member 5
Rat(171373) solute carrier family 12 (potassium-chloride transporter), member 5
domestic guinea pig(100721877) solute carrier family 12 (potassium/chloride transporter), member 5
naked mole-rat(101716676) solute carrier family 12 (potassium/chloride transporter), member 5
cow(510157) solute carrier family 12 (potassium/chloride transporter), member 5
sheep(101114128) solute carrier family 12 (potassium/chloride transporter), member 5
chicken(777252) solute carrier family 12 (potassium/chloride transporter), member 5
Horse(100071141) solute carrier family 12 (potassium/chloride transporter), member 5
domestic cat(101085617) solute carrier family 12 (potassium/chloride transporter), member 5
dog(485905) solute carrier family 12 (potassium/chloride transporter), member 5
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C2366 Anti-K+/Cl- Cotransporter (KCC2) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution canine, rat
western blot pricing
SAB2105548 Anti-SLC12A5 antibody produced in rabbit affinity isolated antibody horse, human, rabbit, guinea pig
western blot pricing
SAB2106659 Anti-SLC12A5 antibody produced in rabbit affinity isolated antibody human, mouse, rabbit
ELISA, western blot pricing
HPA072058 Anti-SLC12A5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB5200231 Monoclonal Anti-Kcc2 - Alkaline Phosphatase antibody produced in mouse clone S1-12, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200232 Monoclonal Anti-Kcc2 - Apc antibody produced in mouse clone S1-12, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200223 Monoclonal Anti-Kcc2 - Atto 390 antibody produced in mouse clone S1-12, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200224 Monoclonal Anti-Kcc2 - Atto 488 antibody produced in mouse clone S1-12, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200225 Monoclonal Anti-Kcc2 - Atto 565 antibody produced in mouse clone S1-12, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200226 Monoclonal Anti-Kcc2 - Atto 594 antibody produced in mouse clone S1-12, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200227 Monoclonal Anti-Kcc2 - Atto 633 antibody produced in mouse clone S1-12, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200228 Monoclonal Anti-Kcc2 - Atto 655 antibody produced in mouse clone S1-12, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200229 Monoclonal Anti-Kcc2 - Atto 680 antibody produced in mouse clone S1-12, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200230 Monoclonal Anti-Kcc2 - Atto 700 antibody produced in mouse clone S1-12, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200233 Monoclonal Anti-Kcc2 - Biotin antibody produced in mouse clone S1-12, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200234 Monoclonal Anti-Kcc2 - Fitc antibody produced in mouse clone S1-12, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200235 Monoclonal Anti-Kcc2 - Hrp antibody produced in mouse clone S1-12, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200236 Monoclonal Anti-Kcc2 - PE/Atto 594 antibody produced in mouse clone S1-12, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200237 Monoclonal Anti-Kcc2 - PerCP antibody produced in mouse clone S1-12, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200238 Monoclonal Anti-Kcc2 - RPE antibody produced in mouse clone S1-12, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200239 Monoclonal Anti-Kcc2 - Streptavidin antibody produced in mouse clone S1-12, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation, western blot pricing
SAB5200222 Monoclonal Anti-Kcc2 antibody produced in mouse clone S1-12, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020708 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020708 Rosetta Predictions human pricing
NM_134363 Rosetta Predictions rat pricing
NM_020333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032379 predicted 1324
2 SASI_Hs02_00353712 predicted 2572
3 SASI_Hs01_00032380 predicted 1309
4 SASI_Hs01_00032381 predicted 1548
5 SASI_Hs01_00032382 predicted 1310
6 SASI_Hs01_00032383 predicted 250
7 SASI_Hs01_00032384 predicted 1374
8 SASI_Hs01_00032385 predicted 2834
9 SASI_Hs01_00032386 predicted 1986
10 SASI_Hs01_00032387 predicted 2934
11 SASI_Hs01_00032388 predicted 2581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039122 predicted 2312
2 SASI_Rn01_00039123 predicted 2220
3 SASI_Rn01_00039124 predicted 2796
4 SASI_Rn01_00039125 predicted 2469
5 SASI_Rn02_00267924 predicted 3213
6 SASI_Rn01_00039126 predicted 224
7 SASI_Rn01_00039127 predicted 2819
8 SASI_Rn01_00039128 predicted 2473
9 SASI_Rn01_00039129 predicted 432
10 SASI_Rn01_00039131 predicted 2532
11 SASI_Rn01_00039130 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173493 predicted 2610
2 SASI_Mm02_00325535 predicted 3097
3 SASI_Mm01_00173494 predicted 2106
4 SASI_Mm01_00173495 predicted 1036
5 SASI_Mm01_00173496 predicted 1588
6 SASI_Mm01_00173497 predicted 2761
7 SASI_Mm01_00173498 predicted 832
8 SASI_Mm01_00173499 predicted 3420
9 SASI_Mm01_00173500 predicted 2829
10 SASI_Mm01_00173501 predicted 1813
11 SASI_Mm01_00173502 predicted 3347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020708
SLC12A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12 (potassium/chloride transporter), member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020708.3-4049s1c1
Sequence:CCGGCCCATATTTATGTGACTAGAACTCGAGTTCTAGTCACATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-1313s1c1
Sequence:CCGGCCCTTATGTCTTCAGTGATATCTCGAGATATCACTGAAGACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-3382s1c1
Sequence:CCGGGCAACCGCAATGGTGATGAAACTCGAGTTTCATCACCATTGCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-2840s1c1
Sequence:CCGGCTCAGCTTACACCTATGAGAACTCGAGTTCTCATAGGTGTAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-1597s1c1
Sequence:CCGGCATGGGTAATTGTCATCGGATCTCGAGATCCGATGACAATTACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020708
SLC12A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12 (potassium/chloride transporter), member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020708.3-4049s1c1
Sequence:CCGGCCCATATTTATGTGACTAGAACTCGAGTTCTAGTCACATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-1313s1c1
Sequence:CCGGCCCTTATGTCTTCAGTGATATCTCGAGATATCACTGAAGACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-3382s1c1
Sequence:CCGGGCAACCGCAATGGTGATGAAACTCGAGTTTCATCACCATTGCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-2840s1c1
Sequence:CCGGCTCAGCTTACACCTATGAGAACTCGAGTTCTCATAGGTGTAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-1597s1c1
Sequence:CCGGCATGGGTAATTGTCATCGGATCTCGAGATCCGATGACAATTACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020708
SLC12A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12 (potassium/chloride transporter), member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020708.3-4049s1c1
Sequence:CCGGCCCATATTTATGTGACTAGAACTCGAGTTCTAGTCACATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-1313s1c1
Sequence:CCGGCCCTTATGTCTTCAGTGATATCTCGAGATATCACTGAAGACATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-3382s1c1
Sequence:CCGGGCAACCGCAATGGTGATGAAACTCGAGTTTCATCACCATTGCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-2840s1c1
Sequence:CCGGCTCAGCTTACACCTATGAGAACTCGAGTTCTCATAGGTGTAAGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020708.3-1597s1c1
Sequence:CCGGCATGGGTAATTGTCATCGGATCTCGAGATCCGATGACAATTACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020333
SLC12A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 12 (potassium/chloride transporter), member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-715s1c1
Sequence:CCGGGCCATCTTCAAGGCAGAAGATCTCGAGATCTTCTGCCTTGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-1956s1c1
Sequence:CCGGCGGACTCATTTATAAGTACATCTCGAGATGTACTTATAAATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-535s1c1
Sequence:CCGGGCAATCGCAACCAATGGTGTTCTCGAGAACACCATTGGTTGCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-1260s1c1
Sequence:CCGGCAGTGATATGACCTCCTACTTCTCGAGAAGTAGGAGGTCATATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-2786s1c1
Sequence:CCGGCCTACGAGAAGACATTAGTAACTCGAGTTACTAATGTCTTCTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020333
SLC12A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 12 (potassium/chloride transporter), member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-715s1c1
Sequence:CCGGGCCATCTTCAAGGCAGAAGATCTCGAGATCTTCTGCCTTGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-1956s1c1
Sequence:CCGGCGGACTCATTTATAAGTACATCTCGAGATGTACTTATAAATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-535s1c1
Sequence:CCGGGCAATCGCAACCAATGGTGTTCTCGAGAACACCATTGGTTGCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-1260s1c1
Sequence:CCGGCAGTGATATGACCTCCTACTTCTCGAGAAGTAGGAGGTCATATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-2786s1c1
Sequence:CCGGCCTACGAGAAGACATTAGTAACTCGAGTTACTAATGTCTTCTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020333
SLC12A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 12 (potassium/chloride transporter), member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-715s1c1
Sequence:CCGGGCCATCTTCAAGGCAGAAGATCTCGAGATCTTCTGCCTTGAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-1956s1c1
Sequence:CCGGCGGACTCATTTATAAGTACATCTCGAGATGTACTTATAAATGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-535s1c1
Sequence:CCGGGCAATCGCAACCAATGGTGTTCTCGAGAACACCATTGGTTGCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-1260s1c1
Sequence:CCGGCAGTGATATGACCTCCTACTTCTCGAGAAGTAGGAGGTCATATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020333.1-2786s1c1
Sequence:CCGGCCTACGAGAAGACATTAGTAACTCGAGTTACTAATGTCTTCTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks