EMAIL THIS PAGE TO A FRIEND

SLC15A2

solute carrier family 15 (oligopeptide transporter), member 2

Synonyms: PEPT2
UniProtKB ID: Q16348, A8K1A5, B4E2A7
Gene ID:
Human(6565) Summary: The mammalian kidney expresses a proton-coupled peptide transporter that is responsible for the absorption of small peptides, as well as beta-lactam antibiotics and other peptide-like drugs, from the tubular filtrate. This transporter, SLC15A2, belongs to the same gene family as SLC15A1 (MIM 600544), the proton-coupled peptide transporter found in the small intestine (Liu et al, 1995 [PubMed 7756356]
Mouse(57738) solute carrier family 15 (H+/peptide transporter), member 2
Rat(60577) solute carrier family 15 (oligopeptide transporter), member 2
Zebrafish(556684) solute carrier family 15 (H+/peptide transporter), member 2
domestic cat(101085825) solute carrier family 15 (H+/peptide transporter), member 2
Horse(100070712) solute carrier family 15 (H+/peptide transporter), member 2
chicken(424244) solute carrier family 15 (H+/peptide transporter), member 2
dog(488006) solute carrier family 15 (H+/peptide transporter), member 2
cow(506921) solute carrier family 15 (H+/peptide transporter), member 2
naked mole-rat(101722906) solute carrier family 15 (H+/peptide transporter), member 2
Domestic Rabbit(100009433) solute carrier family 15 (H+/peptide transporter), member 2
domestic guinea pig(100724012) solute carrier family 15 (H+/peptide transporter), member 2
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021082 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032711 MISSION® esiRNA esiRNA targeting mouse Slc15a2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021082 Rosetta Predictions human pricing
NM_031672 Rosetta Predictions rat pricing
NM_021301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354572 predicted 1611
2 SASI_Hs01_00160363 predicted 380
3 SASI_Hs01_00160364 predicted 1146
4 SASI_Hs01_00160365 predicted 2009
5 SASI_Hs01_00160366 predicted 1569
6 SASI_Hs01_00160367 predicted 1383
7 SASI_Hs01_00160369 predicted 901
8 SASI_Hs01_00160370 predicted 569
9 SASI_Hs01_00160371 predicted 1653
10 SASI_Hs01_00160372 predicted 265
11 SASI_Hs01_00160368 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033092 predicted 2237
2 SASI_Rn01_00033093 predicted 1132
3 SASI_Rn01_00033095 predicted 1264
4 SASI_Rn02_00265014 predicted 2321
5 SASI_Rn01_00033096 predicted 1610
6 SASI_Rn01_00033097 predicted 1877
7 SASI_Rn02_00265015 predicted 1973
8 SASI_Rn01_00033098 predicted 591
9 SASI_Rn01_00033099 predicted 312
10 SASI_Rn01_00033100 predicted 2237
11 SASI_Rn01_00033094 predicted 1818
12 SASI_Rn01_00033101 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325836 predicted 557
2 SASI_Mm01_00188850 predicted 1582
3 SASI_Mm01_00188851 predicted 1818
4 SASI_Mm01_00188852 predicted 356
5 SASI_Mm01_00188853 predicted 1264
6 SASI_Mm01_00188854 predicted 2273
7 SASI_Mm01_00188855 predicted 1917
8 SASI_Mm01_00188856 predicted 1538
9 SASI_Mm01_00188857 predicted 1097
10 SASI_Mm01_00188858 predicted 1686
11 SASI_Mm01_00188849 predicted 1860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021301
SLC15A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021301.1-3663s1c1
Sequence:CCGGCCTCGTATGAAAGACCTCATTCTCGAGAATGAGGTCTTTCATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-2007s1c1
Sequence:CCGGCCAGCCAATAAACTATCCATTCTCGAGAATGGATAGTTTATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-1272s1c1
Sequence:CCGGCCATTGTTTGACCTTGTCATTCTCGAGAATGACAAGGTCAAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-2281s1c1
Sequence:CCGGGCTACTACTATGTTCCTCTAACTCGAGTTAGAGGAACATAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-342s1c1
Sequence:CCGGGCCTTCATTGTGGTGAACGAACTCGAGTTCGTTCACCACAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021301.3-1301s21c1
Sequence:CCGGGATCTCCAAGTGCGGAGTTAACTCGAGTTAACTCCGCACTTGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021301.3-2863s21c1
Sequence:CCGGTACATACGGTATGACCTAATCCTCGAGGATTAGGTCATACCGTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021301.3-1022s21c1
Sequence:CCGGCATTCCAAAGCGACAACATTGCTCGAGCAATGTTGTCGCTTTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021301
SLC15A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021301.1-3663s1c1
Sequence:CCGGCCTCGTATGAAAGACCTCATTCTCGAGAATGAGGTCTTTCATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-2007s1c1
Sequence:CCGGCCAGCCAATAAACTATCCATTCTCGAGAATGGATAGTTTATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-1272s1c1
Sequence:CCGGCCATTGTTTGACCTTGTCATTCTCGAGAATGACAAGGTCAAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-2281s1c1
Sequence:CCGGGCTACTACTATGTTCCTCTAACTCGAGTTAGAGGAACATAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-342s1c1
Sequence:CCGGGCCTTCATTGTGGTGAACGAACTCGAGTTCGTTCACCACAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021301.3-1301s21c1
Sequence:CCGGGATCTCCAAGTGCGGAGTTAACTCGAGTTAACTCCGCACTTGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021301.3-2863s21c1
Sequence:CCGGTACATACGGTATGACCTAATCCTCGAGGATTAGGTCATACCGTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021301.3-1022s21c1
Sequence:CCGGCATTCCAAAGCGACAACATTGCTCGAGCAATGTTGTCGCTTTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021301
SLC15A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021301.1-3663s1c1
Sequence:CCGGCCTCGTATGAAAGACCTCATTCTCGAGAATGAGGTCTTTCATACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-2007s1c1
Sequence:CCGGCCAGCCAATAAACTATCCATTCTCGAGAATGGATAGTTTATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-1272s1c1
Sequence:CCGGCCATTGTTTGACCTTGTCATTCTCGAGAATGACAAGGTCAAACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-2281s1c1
Sequence:CCGGGCTACTACTATGTTCCTCTAACTCGAGTTAGAGGAACATAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021301.1-342s1c1
Sequence:CCGGGCCTTCATTGTGGTGAACGAACTCGAGTTCGTTCACCACAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021301.3-1301s21c1
Sequence:CCGGGATCTCCAAGTGCGGAGTTAACTCGAGTTAACTCCGCACTTGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021301.3-2863s21c1
Sequence:CCGGTACATACGGTATGACCTAATCCTCGAGGATTAGGTCATACCGTATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021301.3-1022s21c1
Sequence:CCGGCATTCCAAAGCGACAACATTGCTCGAGCAATGTTGTCGCTTTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021082
SLC15A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021082.2-2497s1c1
Sequence:CCGGCACACGTATAATGGAGATCATCTCGAGATGATCTCCATTATACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-2115s1c1
Sequence:CCGGGCTACTACTATGTTCCTGTAACTCGAGTTACAGGAACATAGTAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-1106s1c1
Sequence:CCGGCCGTTGTTTGACTTTGTCATTCTCGAGAATGACAAAGTCAAACAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-936s1c1
Sequence:CCGGCCAGGGTACTATTCCTTTATACTCGAGTATAAAGGAATAGTACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-1435s1c1
Sequence:CCGGCCACCTGAAATATCACAATTTCTCGAGAAATTGTGATATTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021082.3-260s21c1
Sequence:CCGGCAATCTGTGGCTCCAACTATCCTCGAGGATAGTTGGAGCCACAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021082.3-2685s21c1
Sequence:CCGGTAGGACTGATGGCCCTAATTTCTCGAGAAATTAGGGCCATCAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021082
SLC15A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021082.2-2497s1c1
Sequence:CCGGCACACGTATAATGGAGATCATCTCGAGATGATCTCCATTATACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-2115s1c1
Sequence:CCGGGCTACTACTATGTTCCTGTAACTCGAGTTACAGGAACATAGTAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-1106s1c1
Sequence:CCGGCCGTTGTTTGACTTTGTCATTCTCGAGAATGACAAAGTCAAACAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-936s1c1
Sequence:CCGGCCAGGGTACTATTCCTTTATACTCGAGTATAAAGGAATAGTACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-1435s1c1
Sequence:CCGGCCACCTGAAATATCACAATTTCTCGAGAAATTGTGATATTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021082.3-260s21c1
Sequence:CCGGCAATCTGTGGCTCCAACTATCCTCGAGGATAGTTGGAGCCACAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021082.3-2685s21c1
Sequence:CCGGTAGGACTGATGGCCCTAATTTCTCGAGAAATTAGGGCCATCAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021082
SLC15A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021082.2-2497s1c1
Sequence:CCGGCACACGTATAATGGAGATCATCTCGAGATGATCTCCATTATACGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-2115s1c1
Sequence:CCGGGCTACTACTATGTTCCTGTAACTCGAGTTACAGGAACATAGTAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-1106s1c1
Sequence:CCGGCCGTTGTTTGACTTTGTCATTCTCGAGAATGACAAAGTCAAACAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-936s1c1
Sequence:CCGGCCAGGGTACTATTCCTTTATACTCGAGTATAAAGGAATAGTACCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021082.2-1435s1c1
Sequence:CCGGCCACCTGAAATATCACAATTTCTCGAGAAATTGTGATATTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021082.3-260s21c1
Sequence:CCGGCAATCTGTGGCTCCAACTATCCTCGAGGATAGTTGGAGCCACAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021082.3-2685s21c1
Sequence:CCGGTAGGACTGATGGCCCTAATTTCTCGAGAAATTAGGGCCATCAGTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks