EMAIL THIS PAGE TO A FRIEND

SLC15A3

solute carrier family 15 (oligopeptide transporter), member 3

Synonyms: OCTP PHT2 PTR3
UniProtKB ID: Q8IY34, Q9P2X9
Gene ID:
Mouse(65221) solute carrier family 15, member 3
Rat(246239) solute carrier family 15 (oligopeptide transporter), member 3
domestic guinea pig(100722522) solute carrier family 15, member 3
Domestic Rabbit(100354666) solute carrier family 15, member 3
naked mole-rat(101708804) solute carrier family 15, member 3
cow(513984) solute carrier family 15 (oligopeptide transporter), member 3
sheep(101122065) solute carrier family 15, member 3
dog(612351) solute carrier family 15, member 3
Horse(100062045) solute carrier family 15, member 3
domestic cat(101082776) solute carrier family 15, member 3
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007491 MISSION® esiRNA esiRNA targeting human SLC15A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016582 Rosetta Predictions human pricing
NM_139341 Rosetta Predictions rat pricing
NM_023044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015526 predicted 1810
2 SASI_Hs01_00015527 predicted 1140
3 SASI_Hs01_00015528 predicted 935
4 SASI_Hs01_00015529 predicted 1359
5 SASI_Hs01_00015530 predicted 1596
6 SASI_Hs01_00015531 predicted 1204
7 SASI_Hs01_00015532 predicted 1166
8 SASI_Hs01_00015533 predicted 1017
9 SASI_Hs01_00015534 predicted 1020
10 SASI_Hs02_00349711 predicted 1235
11 SASI_Hs01_00015525 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067090 predicted 686
2 SASI_Rn01_00067091 predicted 1424
3 SASI_Rn01_00067093 predicted 1557
4 SASI_Rn01_00067094 predicted 1050
5 SASI_Rn02_00268601 predicted 677
6 SASI_Rn01_00067096 predicted 988
7 SASI_Rn01_00067098 predicted 1240
8 SASI_Rn02_00268602 predicted 854
9 SASI_Rn02_00268603 predicted 1689
10 SASI_Rn02_00268604 predicted 1414
11 SASI_Rn01_00067092 predicted 1002
12 SASI_Rn01_00067095 predicted 258
13 SASI_Rn01_00067097 predicted 1684
14 SASI_Rn01_00067099 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046507 predicted 1952
2 SASI_Mm01_00046508 predicted 1570
3 SASI_Mm01_00046509 predicted 1600
4 SASI_Mm01_00046510 predicted 823
5 SASI_Mm01_00046511 predicted 1096
6 SASI_Mm01_00046512 predicted 1480
7 SASI_Mm01_00046513 predicted 1384
8 SASI_Mm01_00046514 predicted 1541
9 SASI_Mm01_00046515 predicted 1082
10 SASI_Mm02_00326738 predicted 663
11 SASI_Mm01_00046516 predicted 1266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016582
VALIDATED
SLC15A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1628s21c1
Sequence:CCGGACCTGCTCATTGGGATCAGTGCTCGAGCACTGATCCCAATGAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1073s21c1
Sequence:CCGGACTCGGCCAGAGACCGTCAATCTCGAGATTGACGGTCTCTGGCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1173s21c1
Sequence:CCGGGGTGAAGATCTTGCCCGTCATCTCGAGATGACGGGCAAGATCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-887s21c1
Sequence:CCGGCGTTTATTCAGCAGAACATCACTCGAGTGATGTTCTGCTGAATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-408s1c1
Sequence:CCGGGTACCTCAACAGCACCAACTTCTCGAGAAGTTGGTGCTGTTGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-1405s1c1
Sequence:CCGGGACCGCTTGATCGACCCTTTACTCGAGTAAAGGGTCGATCAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016582.1-1212s1c1
Sequence:CCGGCTGGATGGTCTACTTCCAGATCTCGAGATCTGGAAGTAGACCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016582.1-1819s1c1
Sequence:CCGGGACTTTGGGAACATCAACAATCTCGAGATTGTTGATGTTCCCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-1530s1c1
Sequence:CCGGCTTACACTACATCCACCACAACTCGAGTTGTGGTGGATGTAGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016582
VALIDATED
SLC15A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1628s21c1
Sequence:CCGGACCTGCTCATTGGGATCAGTGCTCGAGCACTGATCCCAATGAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1073s21c1
Sequence:CCGGACTCGGCCAGAGACCGTCAATCTCGAGATTGACGGTCTCTGGCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1173s21c1
Sequence:CCGGGGTGAAGATCTTGCCCGTCATCTCGAGATGACGGGCAAGATCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-887s21c1
Sequence:CCGGCGTTTATTCAGCAGAACATCACTCGAGTGATGTTCTGCTGAATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-408s1c1
Sequence:CCGGGTACCTCAACAGCACCAACTTCTCGAGAAGTTGGTGCTGTTGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-1405s1c1
Sequence:CCGGGACCGCTTGATCGACCCTTTACTCGAGTAAAGGGTCGATCAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016582.1-1212s1c1
Sequence:CCGGCTGGATGGTCTACTTCCAGATCTCGAGATCTGGAAGTAGACCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016582.1-1819s1c1
Sequence:CCGGGACTTTGGGAACATCAACAATCTCGAGATTGTTGATGTTCCCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-1530s1c1
Sequence:CCGGCTTACACTACATCCACCACAACTCGAGTTGTGGTGGATGTAGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016582
VALIDATED
SLC15A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1628s21c1
Sequence:CCGGACCTGCTCATTGGGATCAGTGCTCGAGCACTGATCCCAATGAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1073s21c1
Sequence:CCGGACTCGGCCAGAGACCGTCAATCTCGAGATTGACGGTCTCTGGCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-1173s21c1
Sequence:CCGGGGTGAAGATCTTGCCCGTCATCTCGAGATGACGGGCAAGATCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016582.2-887s21c1
Sequence:CCGGCGTTTATTCAGCAGAACATCACTCGAGTGATGTTCTGCTGAATAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-408s1c1
Sequence:CCGGGTACCTCAACAGCACCAACTTCTCGAGAAGTTGGTGCTGTTGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-1405s1c1
Sequence:CCGGGACCGCTTGATCGACCCTTTACTCGAGTAAAGGGTCGATCAAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016582.1-1212s1c1
Sequence:CCGGCTGGATGGTCTACTTCCAGATCTCGAGATCTGGAAGTAGACCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016582.1-1819s1c1
Sequence:CCGGGACTTTGGGAACATCAACAATCTCGAGATTGTTGATGTTCCCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016582.1-1530s1c1
Sequence:CCGGCTTACACTACATCCACCACAACTCGAGTTGTGGTGGATGTAGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023044
SLC15A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1342s21c1
Sequence:CCGGTTGCCTGACCAGAGGTCTAACCTCGAGGTTAGACCTCTGGTCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1801s21c1
Sequence:CCGGCTGATTGGGAAGGACTTATACCTCGAGGTATAAGTCCTTCCCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1604s21c1
Sequence:CCGGATGTTGCGGTGATCCTGATTCCTCGAGGAATCAGGATCACCGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1094s21c1
Sequence:CCGGTCAACCTGGGTGCCATATTGTCTCGAGACAATATGGCACCCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1525s21c1
Sequence:CCGGACCAACCCTAACATCTCTTTGCTCGAGCAAAGAGATGTTAGGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1074s1c1
Sequence:CCGGCGCTTCTTCAACTGGTTCTATCTCGAGATAGAACCAGTTGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1451s1c1
Sequence:CCGGGCCTTATTGGATGGTATATTTCTCGAGAAATATACCATCCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-659s1c1
Sequence:CCGGCTACCTCAACAGCTTGAACTTCTCGAGAAGTTCAAGCTGTTGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1638s1c1
Sequence:CCGGCCTGTCAAGGATCACTTGATTCTCGAGAATCAAGTGATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-2133s1c1
Sequence:CCGGGCCGTCCTGTTTCTCTGGATTCTCGAGAATCCAGAGAAACAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023044
SLC15A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1342s21c1
Sequence:CCGGTTGCCTGACCAGAGGTCTAACCTCGAGGTTAGACCTCTGGTCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1801s21c1
Sequence:CCGGCTGATTGGGAAGGACTTATACCTCGAGGTATAAGTCCTTCCCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1604s21c1
Sequence:CCGGATGTTGCGGTGATCCTGATTCCTCGAGGAATCAGGATCACCGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1094s21c1
Sequence:CCGGTCAACCTGGGTGCCATATTGTCTCGAGACAATATGGCACCCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1525s21c1
Sequence:CCGGACCAACCCTAACATCTCTTTGCTCGAGCAAAGAGATGTTAGGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1074s1c1
Sequence:CCGGCGCTTCTTCAACTGGTTCTATCTCGAGATAGAACCAGTTGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1451s1c1
Sequence:CCGGGCCTTATTGGATGGTATATTTCTCGAGAAATATACCATCCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-659s1c1
Sequence:CCGGCTACCTCAACAGCTTGAACTTCTCGAGAAGTTCAAGCTGTTGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1638s1c1
Sequence:CCGGCCTGTCAAGGATCACTTGATTCTCGAGAATCAAGTGATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-2133s1c1
Sequence:CCGGGCCGTCCTGTTTCTCTGGATTCTCGAGAATCCAGAGAAACAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023044
SLC15A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1342s21c1
Sequence:CCGGTTGCCTGACCAGAGGTCTAACCTCGAGGTTAGACCTCTGGTCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1801s21c1
Sequence:CCGGCTGATTGGGAAGGACTTATACCTCGAGGTATAAGTCCTTCCCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1604s21c1
Sequence:CCGGATGTTGCGGTGATCCTGATTCCTCGAGGAATCAGGATCACCGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1094s21c1
Sequence:CCGGTCAACCTGGGTGCCATATTGTCTCGAGACAATATGGCACCCAGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023044.2-1525s21c1
Sequence:CCGGACCAACCCTAACATCTCTTTGCTCGAGCAAAGAGATGTTAGGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1074s1c1
Sequence:CCGGCGCTTCTTCAACTGGTTCTATCTCGAGATAGAACCAGTTGAAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1451s1c1
Sequence:CCGGGCCTTATTGGATGGTATATTTCTCGAGAAATATACCATCCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-659s1c1
Sequence:CCGGCTACCTCAACAGCTTGAACTTCTCGAGAAGTTCAAGCTGTTGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-1638s1c1
Sequence:CCGGCCTGTCAAGGATCACTTGATTCTCGAGAATCAAGTGATCCTTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023044.1-2133s1c1
Sequence:CCGGGCCGTCCTGTTTCTCTGGATTCTCGAGAATCCAGAGAAACAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks