EMAIL THIS PAGE TO A FRIEND

SLC15A4

solute carrier family 15 (oligopeptide transporter), member 4

Synonyms: PHT1 PTR4
UniProtKB ID: Q8N697, A6H8Y9, B3KTK1, Q71M34, Q7Z5F8, Q8TAH0
Gene ID:
Mouse(100561) solute carrier family 15, member 4
Rat(246280) solute carrier family 15 (oligopeptide transporter), member 4
Zebrafish(393932) solute carrier family 15, member 4
domestic cat(101081931) solute carrier family 15, member 4
dog(610055) solute carrier family 15, member 4
chicken(416808) solute carrier family 15, member 4
cow(510499) solute carrier family 15, member 4
sheep(101119254) solute carrier family 15, member 4
naked mole-rat(101702501) solute carrier family 15, member 4
Domestic Rabbit(100354738) solute carrier family 15, member 4
domestic guinea pig(100728924) solute carrier family 15, member 4
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016713 Anti-SLC15A4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
AV44108 Anti-SLC15A4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2102167 Anti-SLC15A4 antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, guinea pig, rat, bovine, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145648 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145648 Rosetta Predictions human pricing
NM_144758 Rosetta Predictions rat pricing
NM_133895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161710 predicted 1617
2 SASI_Hs01_00161711 predicted 1202
3 SASI_Hs01_00161713 predicted 1509
4 SASI_Hs01_00161714 predicted 984
5 SASI_Hs01_00161715 predicted 1717
6 SASI_Hs01_00161716 predicted 1025
7 SASI_Hs01_00161717 predicted 1632
8 SASI_Hs01_00161718 predicted 948
9 SASI_Hs02_00365266 predicted 980
10 SASI_Hs02_00365267 predicted 880
11 SASI_Hs01_00161709 predicted 911
12 SASI_Hs01_00161712 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070223 predicted 652
2 SASI_Rn01_00070224 predicted 1395
3 SASI_Rn01_00070225 predicted 1275
4 SASI_Rn01_00070226 predicted 619
5 SASI_Rn01_00070227 predicted 1385
6 SASI_Rn01_00070228 predicted 1081
7 SASI_Rn01_00070229 predicted 651
8 SASI_Rn01_00070230 predicted 795
9 SASI_Rn01_00070231 predicted 945
10 SASI_Rn01_00070232 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182207 predicted 658
2 SASI_Mm01_00182208 predicted 1395
3 SASI_Mm01_00182209 predicted 1040
4 SASI_Mm01_00182210 predicted 1279
5 SASI_Mm01_00182211 predicted 629
6 SASI_Mm01_00182212 predicted 1083
7 SASI_Mm01_00182213 predicted 662
8 SASI_Mm02_00338949 predicted 1307
9 SASI_Mm01_00182214 predicted 1482
10 SASI_Mm02_00338950 predicted 1020
11 SASI_Mm01_00182215 predicted 951
12 SASI_Mm01_00182216 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133895
SLC15A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1406s1c1
Sequence:CCGGCATTGGCATCAGTGAGATATTCTCGAGAATATCTCACTGATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1616s1c1
Sequence:CCGGCCACCTGCATTACTACTTCTTCTCGAGAAGAAGTAGTAATGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1676s1c1
Sequence:CCGGCCTCATTGTGTCTGTGAAGTACTCGAGTACTTCACAGACACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1281s1c1
Sequence:CCGGGCAGGAATCCTGGAGAGTAAACTCGAGTTTACTCTCCAGGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-761s1c1
Sequence:CCGGCCAGAGTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1616s21c1
Sequence:CCGGCCACCTGCATTACTACTTCTTCTCGAGAAGAAGTAGTAATGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1281s21c1
Sequence:CCGGGCAGGAATCCTGGAGAGTAAACTCGAGTTTACTCTCCAGGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1676s21c1
Sequence:CCGGCCTCATTGTGTCTGTGAAGTACTCGAGTACTTCACAGACACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1406s21c1
Sequence:CCGGCATTGGCATCAGTGAGATATTCTCGAGAATATCTCACTGATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-761s21c1
Sequence:CCGGCCAGAGTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133895
SLC15A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1406s1c1
Sequence:CCGGCATTGGCATCAGTGAGATATTCTCGAGAATATCTCACTGATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1616s1c1
Sequence:CCGGCCACCTGCATTACTACTTCTTCTCGAGAAGAAGTAGTAATGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1676s1c1
Sequence:CCGGCCTCATTGTGTCTGTGAAGTACTCGAGTACTTCACAGACACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1281s1c1
Sequence:CCGGGCAGGAATCCTGGAGAGTAAACTCGAGTTTACTCTCCAGGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-761s1c1
Sequence:CCGGCCAGAGTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1616s21c1
Sequence:CCGGCCACCTGCATTACTACTTCTTCTCGAGAAGAAGTAGTAATGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1281s21c1
Sequence:CCGGGCAGGAATCCTGGAGAGTAAACTCGAGTTTACTCTCCAGGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1676s21c1
Sequence:CCGGCCTCATTGTGTCTGTGAAGTACTCGAGTACTTCACAGACACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1406s21c1
Sequence:CCGGCATTGGCATCAGTGAGATATTCTCGAGAATATCTCACTGATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-761s21c1
Sequence:CCGGCCAGAGTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133895
SLC15A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1406s1c1
Sequence:CCGGCATTGGCATCAGTGAGATATTCTCGAGAATATCTCACTGATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1616s1c1
Sequence:CCGGCCACCTGCATTACTACTTCTTCTCGAGAAGAAGTAGTAATGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1676s1c1
Sequence:CCGGCCTCATTGTGTCTGTGAAGTACTCGAGTACTTCACAGACACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-1281s1c1
Sequence:CCGGGCAGGAATCCTGGAGAGTAAACTCGAGTTTACTCTCCAGGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133895.1-761s1c1
Sequence:CCGGCCAGAGTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1616s21c1
Sequence:CCGGCCACCTGCATTACTACTTCTTCTCGAGAAGAAGTAGTAATGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1281s21c1
Sequence:CCGGGCAGGAATCCTGGAGAGTAAACTCGAGTTTACTCTCCAGGATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1676s21c1
Sequence:CCGGCCTCATTGTGTCTGTGAAGTACTCGAGTACTTCACAGACACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-1406s21c1
Sequence:CCGGCATTGGCATCAGTGAGATATTCTCGAGAATATCTCACTGATGCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133895.1-761s21c1
Sequence:CCGGCCAGAGTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145648
VALIDATED
SLC15A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 15 (oligopeptide transporter), member 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-1642s1c1
Sequence:CCGGCGGCTGCTATTTGAACTATTACTCGAGTAATAGTTCAAATAGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145648.1-1276s1c1
Sequence:CCGGCGTGGGCATGTTCTTTGTCATCTCGAGATGACAAAGAACATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-837s1c1
Sequence:CCGGTGTTCAAGATACTGACGTATTCTCGAGAATACGTCAGTATCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145648.1-906s1c1
Sequence:CCGGGCATTGGAGTCTTTCAGCAATCTCGAGATTGCTGAAAGACTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-1614s1c1
Sequence:CCGGGCAGTCACACAGACTTTGGTACTCGAGTACCAAAGTCTGTGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145648.3-1443s21c1
Sequence:CCGGAGCGAGATCTTTGCAAGTATCCTCGAGGATACTTGCAAAGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-2003s21c1
Sequence:CCGGGAGCTGCAGATTTCGAGTATGCTCGAGCATACTCGAAATCTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-681s21c1
Sequence:CCGGTTAGGTGGCATTGCCTATATTCTCGAGAATATAGGCAATGCCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-1207s21c1
Sequence:CCGGACAAACTGGTCGATCCCATTTCTCGAGAAATGGGATCGACCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-615s21c1
Sequence:CCGGCCGGAAGCCACTAGGAGATTTCTCGAGAAATCTCCTAGTGGCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-1902s21c1
Sequence:CCGGGCATGTTGCCTGGATTGATTTCTCGAGAAATCAATCCAGGCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145648
VALIDATED
SLC15A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 15 (oligopeptide transporter), member 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-1642s1c1
Sequence:CCGGCGGCTGCTATTTGAACTATTACTCGAGTAATAGTTCAAATAGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145648.1-1276s1c1
Sequence:CCGGCGTGGGCATGTTCTTTGTCATCTCGAGATGACAAAGAACATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-837s1c1
Sequence:CCGGTGTTCAAGATACTGACGTATTCTCGAGAATACGTCAGTATCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145648.1-906s1c1
Sequence:CCGGGCATTGGAGTCTTTCAGCAATCTCGAGATTGCTGAAAGACTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-1614s1c1
Sequence:CCGGGCAGTCACACAGACTTTGGTACTCGAGTACCAAAGTCTGTGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145648.3-1443s21c1
Sequence:CCGGAGCGAGATCTTTGCAAGTATCCTCGAGGATACTTGCAAAGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-2003s21c1
Sequence:CCGGGAGCTGCAGATTTCGAGTATGCTCGAGCATACTCGAAATCTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-681s21c1
Sequence:CCGGTTAGGTGGCATTGCCTATATTCTCGAGAATATAGGCAATGCCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-1207s21c1
Sequence:CCGGACAAACTGGTCGATCCCATTTCTCGAGAAATGGGATCGACCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-615s21c1
Sequence:CCGGCCGGAAGCCACTAGGAGATTTCTCGAGAAATCTCCTAGTGGCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-1902s21c1
Sequence:CCGGGCATGTTGCCTGGATTGATTTCTCGAGAAATCAATCCAGGCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145648
VALIDATED
SLC15A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 15 (oligopeptide transporter), member 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-1642s1c1
Sequence:CCGGCGGCTGCTATTTGAACTATTACTCGAGTAATAGTTCAAATAGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145648.1-1276s1c1
Sequence:CCGGCGTGGGCATGTTCTTTGTCATCTCGAGATGACAAAGAACATGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-837s1c1
Sequence:CCGGTGTTCAAGATACTGACGTATTCTCGAGAATACGTCAGTATCTTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145648.1-906s1c1
Sequence:CCGGGCATTGGAGTCTTTCAGCAATCTCGAGATTGCTGAAAGACTCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145648.1-1614s1c1
Sequence:CCGGGCAGTCACACAGACTTTGGTACTCGAGTACCAAAGTCTGTGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145648.3-1443s21c1
Sequence:CCGGAGCGAGATCTTTGCAAGTATCCTCGAGGATACTTGCAAAGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-2003s21c1
Sequence:CCGGGAGCTGCAGATTTCGAGTATGCTCGAGCATACTCGAAATCTGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-681s21c1
Sequence:CCGGTTAGGTGGCATTGCCTATATTCTCGAGAATATAGGCAATGCCACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-1207s21c1
Sequence:CCGGACAAACTGGTCGATCCCATTTCTCGAGAAATGGGATCGACCAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-615s21c1
Sequence:CCGGCCGGAAGCCACTAGGAGATTTCTCGAGAAATCTCCTAGTGGCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_145648.3-1902s21c1
Sequence:CCGGGCATGTTGCCTGGATTGATTTCTCGAGAAATCAATCCAGGCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks