EMAIL THIS PAGE TO A FRIEND

SLC16A3

solute carrier family 16 (monocarboxylate transporter), member 3

Synonyms: MCT 3 MCT 4 MCT-3 MCT-4 MCT3 MCT4
UniProtKB ID: O15427, B3KXG8, Q2M1P8
Gene ID:
Human(9123) Summary: Lactic acid and pyruvate transport across plasma membranes is catalyzed by members of the proton-linked monocarboxylate transporter (MCT) family, which has been designated solute carrier family-16. Each MCT appears to have slightly different substrate and inhibitor specificities and transport kinetics, which are related to the metabolic requirements of the tissues in which it is found. The MCTs, which include MCT1 (SLC16A1; MIM 600682) and MCT2 (SLC16A7; MIM 603654), are characterized by 12 predicted transmembrane domains (Price et al., 1998 [PubMed 9425115]
Mouse(80879) solute carrier family 16 (monocarboxylic acid transporters), member 3
Rat(80878) solute carrier family 16 (monocarboxylate transporter), member 3
domestic guinea pig(100715111) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
naked mole-rat(101703094) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
cow(510085) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
sheep(101111643) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
Zebrafish(327276) solute carrier family 16 (monocarboxylic acid transporters), member 3
chicken(395383) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
dog(483379) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
domestic cat(101091669) solute carrier family 16, member 3 (monocarboxylic acid transporter 4)
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU090341 MISSION® esiRNA esiRNA targeting mouse Slc16a3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042422 Rosetta Predictions human pricing
NM_001042423 Rosetta Predictions human pricing
NM_004207 Rosetta Predictions human pricing
NM_030834 Rosetta Predictions rat pricing
NM_001038653 Rosetta Predictions mouse pricing
NM_001038654 Rosetta Predictions mouse pricing
NM_030696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309658 predicted 1067
2 SASI_Hs02_00309659 predicted 367
3 SASI_Hs02_00309660 predicted 304
4 SASI_Hs02_00309661 predicted 459
5 SASI_Hs02_00309662 predicted 1168
6 SASI_Hs02_00309663 predicted 1655
7 SASI_Hs02_00309664 predicted 1274
8 SASI_Hs02_00309665 predicted 1716
9 SASI_Hs02_00309666 predicted 434
10 SASI_Hs02_00309667 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309668 predicted 1048
2 SASI_Hs02_00309669 predicted 351
3 SASI_Hs02_00309670 predicted 292
4 SASI_Hs02_00309671 predicted 442
5 SASI_Hs02_00309672 predicted 1147
6 SASI_Hs02_00309673 predicted 1634
7 SASI_Hs02_00309674 predicted 1261
8 SASI_Hs02_00309675 predicted 1701
9 SASI_Hs02_00309676 predicted 416
10 SASI_Hs02_00309677 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044495 predicted 1048
2 SASI_Hs01_00044496 predicted 350
3 SASI_Hs01_00044497 predicted 290
4 SASI_Hs01_00044498 predicted 440
5 SASI_Hs01_00044499 predicted 1147
6 SASI_Hs01_00044500 predicted 1631
7 SASI_Hs01_00044501 predicted 1256
8 SASI_Hs01_00044502 predicted 1699
9 SASI_Hs01_00044503 predicted 422
10 SASI_Hs01_00044504 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077093 predicted 821
2 SASI_Rn01_00077094 predicted 1239
3 SASI_Rn01_00077095 predicted 974
4 SASI_Rn02_00264055 predicted 1555
5 SASI_Rn01_00077096 predicted 1706
6 SASI_Rn02_00264056 predicted 1552
7 SASI_Rn01_00077097 predicted 994
8 SASI_Rn01_00077098 predicted 824
9 SASI_Rn01_00077099 predicted 555
10 SASI_Rn01_00077100 predicted 411
11 SASI_Rn01_00077101 predicted 422
12 SASI_Rn01_00077102 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119743 predicted 913
2 SASI_Mm01_00119744 predicted 666
3 SASI_Mm01_00119745 predicted 521
4 SASI_Mm01_00119746 predicted 1245
5 SASI_Mm01_00119747 predicted 1344
6 SASI_Mm02_00289658 predicted 672
7 SASI_Mm01_00119748 predicted 1251
8 SASI_Mm01_00119749 predicted 926
9 SASI_Mm01_00119750 predicted 1653
10 SASI_Mm01_00119752 predicted 1335
11 SASI_Mm01_00119751 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152554 predicted 823
2 SASI_Mm01_00152555 predicted 568
3 SASI_Mm01_00152556 predicted 428
4 SASI_Mm01_00152557 predicted 1141
5 SASI_Mm01_00152558 predicted 1254
6 SASI_Mm02_00289659 predicted 575
7 SASI_Mm01_00152559 predicted 1162
8 SASI_Mm01_00152560 predicted 831
9 SASI_Mm01_00152561 predicted 1551
10 SASI_Mm01_00152563 predicted 1248
11 SASI_Mm01_00152562 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133791 predicted 925
2 SASI_Mm01_00133792 predicted 672
3 SASI_Mm01_00133793 predicted 534
4 SASI_Mm01_00133794 predicted 1257
5 SASI_Mm01_00133795 predicted 1357
6 SASI_Mm02_00336865 predicted 681
7 SASI_Mm01_00133796 predicted 1263
8 SASI_Mm01_00133797 predicted 940
9 SASI_Mm01_00133798 predicted 1657
10 SASI_Mm01_00133800 predicted 1348
11 SASI_Mm01_00133799 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004207
VALIDATED
SLC16A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 16 (monocarboxylate transporter), member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-1266s21c1
Sequence:CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004207.2-1095s21c1
Sequence:CCGGCATCTTCTTTGGCATCTCCTACTCGAGTAGGAGATGCCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-264s21c1
Sequence:CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-519s21c1
Sequence:CCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-461s1c1
Sequence:CCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-1037s1c1
Sequence:CCGGCATCTTCTTTGGCATCTCCTACTCGAGTAGGAGATGCCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-1287s1c1
Sequence:CCGGTGCATTAGGAAGAAGCCCAAACTCGAGTTTGGGCTTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004207.1-206s1c1
Sequence:CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004207.1-1208s1c1
Sequence:CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004207
VALIDATED
SLC16A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 16 (monocarboxylate transporter), member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-1266s21c1
Sequence:CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004207.2-1095s21c1
Sequence:CCGGCATCTTCTTTGGCATCTCCTACTCGAGTAGGAGATGCCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-264s21c1
Sequence:CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-519s21c1
Sequence:CCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-461s1c1
Sequence:CCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-1037s1c1
Sequence:CCGGCATCTTCTTTGGCATCTCCTACTCGAGTAGGAGATGCCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-1287s1c1
Sequence:CCGGTGCATTAGGAAGAAGCCCAAACTCGAGTTTGGGCTTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004207.1-206s1c1
Sequence:CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004207.1-1208s1c1
Sequence:CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004207
VALIDATED
SLC16A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 16 (monocarboxylate transporter), member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-1266s21c1
Sequence:CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004207.2-1095s21c1
Sequence:CCGGCATCTTCTTTGGCATCTCCTACTCGAGTAGGAGATGCCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-264s21c1
Sequence:CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004207.2-519s21c1
Sequence:CCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-461s1c1
Sequence:CCGGGCTCATCATGCTGAACCGCTACTCGAGTAGCGGTTCAGCATGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-1037s1c1
Sequence:CCGGCATCTTCTTTGGCATCTCCTACTCGAGTAGGAGATGCCAAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004207.1-1287s1c1
Sequence:CCGGTGCATTAGGAAGAAGCCCAAACTCGAGTTTGGGCTTCTTCCTAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004207.1-206s1c1
Sequence:CCGGGCTCATACAGGAGTTTGGGATCTCGAGATCCCAAACTCCTGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004207.1-1208s1c1
Sequence:CCGGCGTCTACATGTACGTGTTCATCTCGAGATGAACACGTACATGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030696
SLC16A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 16 (monocarboxylate transporter), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-611s1c1
Sequence:CCGGCCTCATCATGCTCAATCGATACTCGAGTATCGATTGAGCATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030696.2-1836s1c1
Sequence:CCGGCCCATAGTTATCAGCCACCTACTCGAGTAGGTGGCTGATAACTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-1032s1c1
Sequence:CCGGCTGGGCTTCATCGACATCTTTCTCGAGAAAGATGTCGATGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-1355s1c1
Sequence:CCGGGCTGGATGCAACCAAAGTTTACTCGAGTAAACTTTGGTTGCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-620s1c1
Sequence:CCGGGCTCAATCGATACTTCAACAACTCGAGTTGTTGAAGTATCGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030696
SLC16A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 16 (monocarboxylate transporter), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-611s1c1
Sequence:CCGGCCTCATCATGCTCAATCGATACTCGAGTATCGATTGAGCATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030696.2-1836s1c1
Sequence:CCGGCCCATAGTTATCAGCCACCTACTCGAGTAGGTGGCTGATAACTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-1032s1c1
Sequence:CCGGCTGGGCTTCATCGACATCTTTCTCGAGAAAGATGTCGATGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-1355s1c1
Sequence:CCGGGCTGGATGCAACCAAAGTTTACTCGAGTAAACTTTGGTTGCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-620s1c1
Sequence:CCGGGCTCAATCGATACTTCAACAACTCGAGTTGTTGAAGTATCGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030696
SLC16A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 16 (monocarboxylate transporter), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-611s1c1
Sequence:CCGGCCTCATCATGCTCAATCGATACTCGAGTATCGATTGAGCATGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030696.2-1836s1c1
Sequence:CCGGCCCATAGTTATCAGCCACCTACTCGAGTAGGTGGCTGATAACTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-1032s1c1
Sequence:CCGGCTGGGCTTCATCGACATCTTTCTCGAGAAAGATGTCGATGAAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-1355s1c1
Sequence:CCGGGCTGGATGCAACCAAAGTTTACTCGAGTAAACTTTGGTTGCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030696.2-620s1c1
Sequence:CCGGGCTCAATCGATACTTCAACAACTCGAGTTGTTGAAGTATCGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks