EMAIL THIS PAGE TO A FRIEND

SLC17A3

solute carrier family 17 (organic anion transporter), member 3

Synonyms: NPT4
UniProtKB ID: O00476, B7WNJ5, B7Z511, Q8WWC7, Q9H533
Gene ID:
Human(10786) Summary: The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Mouse(105355) solute carrier family 17 (sodium phosphate), member 3
Rat(266730) solute carrier family 17 (organic anion transporter), member 3
Horse(100052814) solute carrier family 17 (sodium phosphate), member 3
domestic cat(101095655) solute carrier family 17 (sodium phosphate), member 3
dog(478741) solute carrier family 17 (sodium phosphate), member 3
cow(519345) solute carrier family 17 (sodium phosphate), member 3
domestic guinea pig(100713191) solute carrier family 17 (sodium phosphate), member 3
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134069 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134069 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134069 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090651 MISSION® esiRNA esiRNA human SLC17A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098486 Rosetta Predictions human pricing
NM_006632 Rosetta Predictions human pricing
NM_153622 Rosetta Predictions rat pricing
NM_134069 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318999 predicted 1057
2 SASI_Hs02_00319000 predicted 1251
3 SASI_Hs02_00319001 predicted 1306
4 SASI_Hs02_00319002 predicted 878
5 SASI_Hs02_00319003 predicted 1417
6 SASI_Hs02_00319004 predicted 1155
7 SASI_Hs02_00319005 predicted 1366
8 SASI_Hs02_00319006 predicted 1426
9 SASI_Hs02_00319007 predicted 912
10 SASI_Hs02_00319008 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243729 predicted 820
2 SASI_Hs01_00243731 predicted 1015
3 SASI_Hs02_00341980 predicted 1072
4 SASI_Hs02_00341981 predicted 644
5 SASI_Hs01_00243734 predicted 1183
6 SASI_Hs01_00243736 predicted 920
7 SASI_Hs01_00243738 predicted 1124
8 SASI_Hs02_00341982 predicted 1190
9 SASI_Hs02_00341983 predicted 685
10 SASI_Hs02_00341984 predicted 765
11 SASI_Hs01_00243730 predicted 1327
12 SASI_Hs01_00243732 predicted 698
13 SASI_Hs01_00243733 predicted 441
14 SASI_Hs01_00243735 predicted 578
15 SASI_Hs01_00243737 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069347 predicted 1298
2 SASI_Rn01_00069348 predicted 1488
3 SASI_Rn01_00069349 predicted 1482
4 SASI_Rn01_00069350 predicted 1021
5 SASI_Rn01_00069352 predicted 493
6 SASI_Rn01_00069353 predicted 1005
7 SASI_Rn01_00069354 predicted 1378
8 SASI_Rn01_00069355 predicted 557
9 SASI_Rn01_00069356 predicted 1007
10 SASI_Rn02_00268993 predicted 1372
11 SASI_Rn01_00069351 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339257 predicted 1051
2 SASI_Mm01_00084077 predicted 623
3 SASI_Mm01_00084078 predicted 690
4 SASI_Mm01_00084079 predicted 582
5 SASI_Mm01_00084080 predicted 1575
6 SASI_Mm01_00084082 predicted 1255
7 SASI_Mm01_00084083 predicted 1225
8 SASI_Mm01_00084084 predicted 1024
9 SASI_Mm01_00084085 predicted 1015
10 SASI_Mm01_00084086 predicted 1479
11 SASI_Mm01_00084081 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134069
SLC17A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (organic anion transporter), member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134069.3-779s21c1
Sequence:CCGGCGAGCAGTTCAAGGCTTAATGCTCGAGCATTAAGCCTTGAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134069.3-394s21c1
Sequence:CCGGCGTCACACATTTCTGCAATTTCTCGAGAAATTGCAGAAATGTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134069.2-1818s1c1
Sequence:CCGGCGGTAATCTTTACTAGAGAAACTCGAGTTTCTCTAGTAAAGATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1475s1c1
Sequence:CCGGGCAGTTAACCTACTTGGCTTACTCGAGTAAGCCAAGTAGGTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1022s1c1
Sequence:CCGGCCAACCTACATCAGTTCTGTACTCGAGTACAGAACTGATGTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1228s1c1
Sequence:CCGGGCCCTATATCCAATCCAGCTACTCGAGTAGCTGGATTGGATATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-153s1c1
Sequence:CCGGCCCTGAAAGTCCCGAGTTTATCTCGAGATAAACTCGGGACTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134069
SLC17A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (organic anion transporter), member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134069.3-779s21c1
Sequence:CCGGCGAGCAGTTCAAGGCTTAATGCTCGAGCATTAAGCCTTGAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134069.3-394s21c1
Sequence:CCGGCGTCACACATTTCTGCAATTTCTCGAGAAATTGCAGAAATGTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134069.2-1818s1c1
Sequence:CCGGCGGTAATCTTTACTAGAGAAACTCGAGTTTCTCTAGTAAAGATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1475s1c1
Sequence:CCGGGCAGTTAACCTACTTGGCTTACTCGAGTAAGCCAAGTAGGTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1022s1c1
Sequence:CCGGCCAACCTACATCAGTTCTGTACTCGAGTACAGAACTGATGTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1228s1c1
Sequence:CCGGGCCCTATATCCAATCCAGCTACTCGAGTAGCTGGATTGGATATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-153s1c1
Sequence:CCGGCCCTGAAAGTCCCGAGTTTATCTCGAGATAAACTCGGGACTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134069
SLC17A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (organic anion transporter), member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134069.3-779s21c1
Sequence:CCGGCGAGCAGTTCAAGGCTTAATGCTCGAGCATTAAGCCTTGAACTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134069.3-394s21c1
Sequence:CCGGCGTCACACATTTCTGCAATTTCTCGAGAAATTGCAGAAATGTGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134069.2-1818s1c1
Sequence:CCGGCGGTAATCTTTACTAGAGAAACTCGAGTTTCTCTAGTAAAGATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1475s1c1
Sequence:CCGGGCAGTTAACCTACTTGGCTTACTCGAGTAAGCCAAGTAGGTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1022s1c1
Sequence:CCGGCCAACCTACATCAGTTCTGTACTCGAGTACAGAACTGATGTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-1228s1c1
Sequence:CCGGGCCCTATATCCAATCCAGCTACTCGAGTAGCTGGATTGGATATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134069.2-153s1c1
Sequence:CCGGCCCTGAAAGTCCCGAGTTTATCTCGAGATAAACTCGGGACTTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006632
SLC17A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (organic anion transporter), member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006632.3-816s21c1
Sequence:CCGGGTTGTATACATACCAACTTACCTCGAGGTAAGTTGGTATGTATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006632.3-1269s21c1
Sequence:CCGGTTCTTGCTGTTTGCCGTTAACCTCGAGGTTAACGGCAAACAGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1244s1c1
Sequence:CCGGCCTTACCTCAATTCCGGCTATCTCGAGATAGCCGGAATTGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-444s1c1
Sequence:CCGGCCCTCGTCTTACATTTCTGCACTCGAGTGCAGAAATGTAAGACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1508s1c1
Sequence:CCGGCTACTCTTCTACCTCATATTTCTCGAGAAATATGAGGTAGAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-614s1c1
Sequence:CCGGCCTGCAAAGTCCTCAATACTTCTCGAGAAGTATTGAGGACTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1145s1c1
Sequence:CCGGGCAGATTTCCTTCTAACCAAACTCGAGTTTGGTTAGAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006632
SLC17A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (organic anion transporter), member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006632.3-816s21c1
Sequence:CCGGGTTGTATACATACCAACTTACCTCGAGGTAAGTTGGTATGTATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006632.3-1269s21c1
Sequence:CCGGTTCTTGCTGTTTGCCGTTAACCTCGAGGTTAACGGCAAACAGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1244s1c1
Sequence:CCGGCCTTACCTCAATTCCGGCTATCTCGAGATAGCCGGAATTGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-444s1c1
Sequence:CCGGCCCTCGTCTTACATTTCTGCACTCGAGTGCAGAAATGTAAGACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1508s1c1
Sequence:CCGGCTACTCTTCTACCTCATATTTCTCGAGAAATATGAGGTAGAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-614s1c1
Sequence:CCGGCCTGCAAAGTCCTCAATACTTCTCGAGAAGTATTGAGGACTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1145s1c1
Sequence:CCGGGCAGATTTCCTTCTAACCAAACTCGAGTTTGGTTAGAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006632
SLC17A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (organic anion transporter), member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006632.3-816s21c1
Sequence:CCGGGTTGTATACATACCAACTTACCTCGAGGTAAGTTGGTATGTATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006632.3-1269s21c1
Sequence:CCGGTTCTTGCTGTTTGCCGTTAACCTCGAGGTTAACGGCAAACAGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1244s1c1
Sequence:CCGGCCTTACCTCAATTCCGGCTATCTCGAGATAGCCGGAATTGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-444s1c1
Sequence:CCGGCCCTCGTCTTACATTTCTGCACTCGAGTGCAGAAATGTAAGACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1508s1c1
Sequence:CCGGCTACTCTTCTACCTCATATTTCTCGAGAAATATGAGGTAGAAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-614s1c1
Sequence:CCGGCCTGCAAAGTCCTCAATACTTCTCGAGAAGTATTGAGGACTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006632.1-1145s1c1
Sequence:CCGGGCAGATTTCCTTCTAACCAAACTCGAGTTTGGTTAGAAGGAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks