EMAIL THIS PAGE TO A FRIEND

SLC17A7

solute carrier family 17 (vesicular glutamate transporter), member 7

Synonyms: BNPI VGLUT1
UniProtKB ID: Q9P2U7, Q6PCD0
Gene ID:
Human(57030) Summary: The protein encoded by this gene is a vesicle-bound, sodium-dependent phosphate transporter that is specifically expressed in the neuron-rich regions of the brain. It is preferentially associated with the membranes of synaptic vesicles and functions in glutamate transport. The protein shares 82% identity with the differentiation-associated Na-dependent inorganic phosphate cotransporter and they appear to form a distinct class within the Na+/Pi cotransporter family. [provided by RefSeq, Jul 2008]
Mouse(72961) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Rat(116638) solute carrier family 17 (vesicular glutamate transporter), member 7
Zebrafish(795293) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
domestic cat(100216332) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
domestic cat(101082282) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
dog(476415) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
cow(518849) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
sheep(101111653) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
naked mole-rat(101701355) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
domestic guinea pig(100728214) solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303470 ANTI-SLC17A7 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
HPA063679 Anti-SLC17A7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA050458 Anti-SLC17A7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
V0389 Anti-VGLUT1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
microarray, western blot pricing
SAB5200267 Monoclonal Anti-Vglut1 - Alkaline Phosphatase antibody produced in mouse clone S28-9, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200268 Monoclonal Anti-Vglut1 - Apc antibody produced in mouse clone S28-9, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200259 Monoclonal Anti-Vglut1 - Atto 390 antibody produced in mouse clone S28-9, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200260 Monoclonal Anti-Vglut1 - Atto 488 antibody produced in mouse clone S28-9, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200261 Monoclonal Anti-Vglut1 - Atto 565 antibody produced in mouse clone S28-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200262 Monoclonal Anti-Vglut1 - Atto 594 antibody produced in mouse clone S28-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200263 Monoclonal Anti-Vglut1 - Atto 633 antibody produced in mouse clone S28-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200264 Monoclonal Anti-Vglut1 - Atto 655 antibody produced in mouse clone S28-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200265 Monoclonal Anti-Vglut1 - Atto 680 antibody produced in mouse clone S28-9, purified immunoglobulin rat, human, mouse
immunohistochemistry, western blot pricing
SAB5200266 Monoclonal Anti-Vglut1 - Atto 700 antibody produced in mouse clone S28-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200269 Monoclonal Anti-Vglut1 - Biotin antibody produced in mouse clone S28-9, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200270 Monoclonal Anti-Vglut1 - Fitc antibody produced in mouse clone S28-9, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200271 Monoclonal Anti-Vglut1 - Hrp antibody produced in mouse clone S28-9, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200272 Monoclonal Anti-Vglut1 - PE/Atto 594 antibody produced in mouse clone S28-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200273 Monoclonal Anti-Vglut1 - PerCP antibody produced in mouse clone S28-9, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200274 Monoclonal Anti-Vglut1 - RPE antibody produced in mouse clone S28-9, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200275 Monoclonal Anti-Vglut1 - Streptavidin antibody produced in mouse clone S28-9, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200258 Monoclonal Anti-Vglut1 antibody produced in mouse clone S28-9, purified immunoglobulin rat, human, mouse
immunohistochemistry, western blot pricing
AMAB91041 Monoclonal Anti-VGLUT1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2754, purified immunoglobulin, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030481 MISSION® esiRNA esiRNA human SLC17A7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020309 Rosetta Predictions human pricing
NM_053859 Rosetta Predictions rat pricing
NM_182993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081979 predicted 2127
2 SASI_Hs01_00081981 predicted 492
3 SASI_Hs01_00081982 predicted 1132
4 SASI_Hs02_00353222 predicted 2016
5 SASI_Hs01_00081983 predicted 590
6 SASI_Hs01_00081984 predicted 2285
7 SASI_Hs01_00081985 predicted 518
8 SASI_Hs01_00081987 predicted 530
9 SASI_Hs01_00081988 predicted 2276
10 SASI_Hs02_00353223 predicted 2288
11 SASI_Hs01_00081980 predicted 2298
12 SASI_Hs01_00081986 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098738 predicted 1227
2 SASI_Rn01_00098739 predicted 591
3 SASI_Rn01_00098740 predicted 1409
4 SASI_Rn01_00098741 predicted 1034
5 SASI_Rn01_00098743 predicted 1367
6 SASI_Rn01_00098744 predicted 1063
7 SASI_Rn01_00098745 predicted 964
8 SASI_Rn01_00098746 predicted 551
9 SASI_Rn01_00098747 predicted 1109
10 SASI_Rn02_00266724 predicted 301
11 SASI_Rn01_00098742 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045502 predicted 1201
2 SASI_Mm01_00045503 predicted 1059
3 SASI_Mm01_00045504 predicted 851
4 SASI_Mm01_00045505 predicted 793
5 SASI_Mm01_00045506 predicted 1046
6 SASI_Mm02_00350002 predicted 925
7 SASI_Mm01_00045507 predicted 498
8 SASI_Mm01_00045508 predicted 1002
9 SASI_Mm01_00045509 predicted 796
10 SASI_Mm01_00045510 predicted 1201
11 SASI_Mm01_00045511 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020309
SLC17A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (vesicular glutamate transporter), member 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-545s1c1
Sequence:CCGGCAGGAGGATTTATCTGTCAAACTCGAGTTTGACAGATAAATCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1549s1c1
Sequence:CCGGTGGCAGTACGTGTTCCTAATTCTCGAGAATTAGGAACACGTACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1041s1c1
Sequence:CCGGCTTCACGTCTATGCCAGTCTACTCGAGTAGACTGGCATAGACGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-600s1c1
Sequence:CCGGTGTGGCAACATCCACTCTAAACTCGAGTTTAGAGTGGATGTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1125s1c1
Sequence:CCGGCGCCTACTTCGAAGAAGTGTTCTCGAGAACACTTCTTCGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020309
SLC17A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (vesicular glutamate transporter), member 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-545s1c1
Sequence:CCGGCAGGAGGATTTATCTGTCAAACTCGAGTTTGACAGATAAATCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1549s1c1
Sequence:CCGGTGGCAGTACGTGTTCCTAATTCTCGAGAATTAGGAACACGTACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1041s1c1
Sequence:CCGGCTTCACGTCTATGCCAGTCTACTCGAGTAGACTGGCATAGACGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-600s1c1
Sequence:CCGGTGTGGCAACATCCACTCTAAACTCGAGTTTAGAGTGGATGTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1125s1c1
Sequence:CCGGCGCCTACTTCGAAGAAGTGTTCTCGAGAACACTTCTTCGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020309
SLC17A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (vesicular glutamate transporter), member 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-545s1c1
Sequence:CCGGCAGGAGGATTTATCTGTCAAACTCGAGTTTGACAGATAAATCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1549s1c1
Sequence:CCGGTGGCAGTACGTGTTCCTAATTCTCGAGAATTAGGAACACGTACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1041s1c1
Sequence:CCGGCTTCACGTCTATGCCAGTCTACTCGAGTAGACTGGCATAGACGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-600s1c1
Sequence:CCGGTGTGGCAACATCCACTCTAAACTCGAGTTTAGAGTGGATGTTGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020309.2-1125s1c1
Sequence:CCGGCGCCTACTTCGAAGAAGTGTTCTCGAGAACACTTCTTCGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182993
SLC17A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (vesicular glutamate transporter), member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182993.1-2063s1c1
Sequence:CCGGCGCCTAACCAATTCTACATTTCTCGAGAAATGTAGAATTGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-860s1c1
Sequence:CCGGGCCATCATCGTTGCGAACTTTCTCGAGAAAGTTCGCAACGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-798s1c1
Sequence:CCGGTGAACCCTGTTACGAAGTTTACTCGAGTAAACTTCGTAACAGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-799s1c1
Sequence:CCGGGAACCCTGTTACGAAGTTTAACTCGAGTTAAACTTCGTAACAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-922s1c1
Sequence:CCGGCGCCTACTTTGAAGAAGTGTTCTCGAGAACACTTCTTCAAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182993
SLC17A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (vesicular glutamate transporter), member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182993.1-2063s1c1
Sequence:CCGGCGCCTAACCAATTCTACATTTCTCGAGAAATGTAGAATTGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-860s1c1
Sequence:CCGGGCCATCATCGTTGCGAACTTTCTCGAGAAAGTTCGCAACGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-798s1c1
Sequence:CCGGTGAACCCTGTTACGAAGTTTACTCGAGTAAACTTCGTAACAGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-799s1c1
Sequence:CCGGGAACCCTGTTACGAAGTTTAACTCGAGTTAAACTTCGTAACAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-922s1c1
Sequence:CCGGCGCCTACTTTGAAGAAGTGTTCTCGAGAACACTTCTTCAAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182993
SLC17A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (vesicular glutamate transporter), member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182993.1-2063s1c1
Sequence:CCGGCGCCTAACCAATTCTACATTTCTCGAGAAATGTAGAATTGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-860s1c1
Sequence:CCGGGCCATCATCGTTGCGAACTTTCTCGAGAAAGTTCGCAACGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-798s1c1
Sequence:CCGGTGAACCCTGTTACGAAGTTTACTCGAGTAAACTTCGTAACAGGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-799s1c1
Sequence:CCGGGAACCCTGTTACGAAGTTTAACTCGAGTTAAACTTCGTAACAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182993.1-922s1c1
Sequence:CCGGCGCCTACTTTGAAGAAGTGTTCTCGAGAACACTTCTTCAAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks