EMAIL THIS PAGE TO A FRIEND

SLC17A9

solute carrier family 17 (vesicular nucleotide transporter), member 9

Synonyms: C20orf59 VNUT
Gene ID:
Mouse(228993) solute carrier family 17, member 9
Rat(362287) solute carrier family 17 (vesicular nucleotide transporter), member 9
chicken(419236) solute carrier family 17, member 9
domestic cat(101081131) solute carrier family 17, member 9
dog(485966) solute carrier family 17, member 9
cow(518062) solute carrier family 17, member 9
sheep(101110694) solute carrier family 17, member 9
naked mole-rat(101709096) solute carrier family 17, member 9
domestic guinea pig(100733930) solute carrier family 17, member 9
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022082 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022082 Rosetta Predictions human pricing
NM_001108613 Rosetta Predictions rat pricing
NM_183161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110400 predicted 340
2 SASI_Hs01_00110401 predicted 371
3 SASI_Hs01_00110402 predicted 1056
4 SASI_Hs01_00110403 predicted 545
5 SASI_Hs01_00110404 predicted 1073
6 SASI_Hs01_00110405 predicted 1185
7 SASI_Hs01_00110406 predicted 1030
8 SASI_Hs02_00355461 predicted 1424
9 SASI_Hs02_00355462 predicted 1337
10 SASI_Hs01_00110407 predicted 1048
11 SASI_Hs01_00110408 predicted 766
12 SASI_Hs01_00110409 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108613 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240359 predicted 1065
2 SASI_Rn02_00240360 predicted 981
3 SASI_Rn02_00240361 predicted 931
4 SASI_Rn02_00240362 predicted 1462
5 SASI_Rn02_00240363 predicted 1109
6 SASI_Rn02_00240364 predicted 519
7 SASI_Rn02_00240365 predicted 247
8 SASI_Rn02_00240366 predicted 789
9 SASI_Rn02_00240367 predicted 997
10 SASI_Rn02_00240368 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103592 predicted 316
2 SASI_Mm02_00350216 predicted 943
3 SASI_Mm02_00350217 predicted 1448
4 SASI_Mm02_00350218 predicted 967
5 SASI_Mm02_00350219 predicted 1354
6 SASI_Mm02_00350220 predicted 1101
7 SASI_Mm02_00350221 predicted 906
8 SASI_Mm02_00350222 predicted 911
9 SASI_Mm02_00350223 predicted 639
10 SASI_Mm02_00350224 predicted 745
11 SASI_Mm01_00103593 predicted 544
12 SASI_Mm01_00103594 predicted 503
13 SASI_Mm01_00103595 predicted 528
14 SASI_Mm01_00103596 predicted 206
15 SASI_Mm01_00103597 predicted 512
16 SASI_Mm01_00103598 predicted 545
17 SASI_Mm01_00103599 predicted 330
18 SASI_Mm01_00103600 predicted 731
19 SASI_Mm01_00103601 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022082
VALIDATED
SLC17A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (vesicular nucleotide transporter), member 9
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-1395s21c1
Sequence:CCGGTCAACCTTGTGGCCATCATCACTCGAGTGATGATGGCCACAAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022082.3-1806s21c1
Sequence:CCGGTCATTCCCACCACGATCTGTTCTCGAGAACAGATCGTGGTGGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022082.3-1234s21c1
Sequence:CCGGCTTCAACCACAGTGGCATTTCCTCGAGGAAATGCCACTGTGGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-730s21c1
Sequence:CCGGCTGGCAGAGCATCTTCTATTTCTCGAGAAATAGAAGATGCTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-1071s21c1
Sequence:CCGGTCTCTGATCATCTCATCAATCCTCGAGGATTGATGAGATGATCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022082.3-1990s21c1
Sequence:CCGGCACACTGTAGGATGCTTAAAGCTCGAGCTTTAAGCATCCTACAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1072s1c1
Sequence:CCGGCTCTCTGATCATCTCATCAATCTCGAGATTGATGAGATGATCAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022082.2-1991s1c1
Sequence:CCGGGCACACTGTAGGATGCTTAAACTCGAGTTTAAGCATCCTACAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1242s1c1
Sequence:CCGGCCACAGTGGCATTTCTGTTAACTCGAGTTAACAGAAATGCCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1251s1c1
Sequence:CCGGCATTTCTGTTAACATCCAGGACTCGAGTCCTGGATGTTAACAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1245s1c1
Sequence:CCGGCAGTGGCATTTCTGTTAACATCTCGAGATGTTAACAGAAATGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022082
VALIDATED
SLC17A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (vesicular nucleotide transporter), member 9
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-1395s21c1
Sequence:CCGGTCAACCTTGTGGCCATCATCACTCGAGTGATGATGGCCACAAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022082.3-1806s21c1
Sequence:CCGGTCATTCCCACCACGATCTGTTCTCGAGAACAGATCGTGGTGGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022082.3-1234s21c1
Sequence:CCGGCTTCAACCACAGTGGCATTTCCTCGAGGAAATGCCACTGTGGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-730s21c1
Sequence:CCGGCTGGCAGAGCATCTTCTATTTCTCGAGAAATAGAAGATGCTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-1071s21c1
Sequence:CCGGTCTCTGATCATCTCATCAATCCTCGAGGATTGATGAGATGATCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022082.3-1990s21c1
Sequence:CCGGCACACTGTAGGATGCTTAAAGCTCGAGCTTTAAGCATCCTACAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1072s1c1
Sequence:CCGGCTCTCTGATCATCTCATCAATCTCGAGATTGATGAGATGATCAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022082.2-1991s1c1
Sequence:CCGGGCACACTGTAGGATGCTTAAACTCGAGTTTAAGCATCCTACAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1242s1c1
Sequence:CCGGCCACAGTGGCATTTCTGTTAACTCGAGTTAACAGAAATGCCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1251s1c1
Sequence:CCGGCATTTCTGTTAACATCCAGGACTCGAGTCCTGGATGTTAACAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1245s1c1
Sequence:CCGGCAGTGGCATTTCTGTTAACATCTCGAGATGTTAACAGAAATGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022082
VALIDATED
SLC17A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (vesicular nucleotide transporter), member 9
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-1395s21c1
Sequence:CCGGTCAACCTTGTGGCCATCATCACTCGAGTGATGATGGCCACAAGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022082.3-1806s21c1
Sequence:CCGGTCATTCCCACCACGATCTGTTCTCGAGAACAGATCGTGGTGGGAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022082.3-1234s21c1
Sequence:CCGGCTTCAACCACAGTGGCATTTCCTCGAGGAAATGCCACTGTGGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-730s21c1
Sequence:CCGGCTGGCAGAGCATCTTCTATTTCTCGAGAAATAGAAGATGCTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022082.3-1071s21c1
Sequence:CCGGTCTCTGATCATCTCATCAATCCTCGAGGATTGATGAGATGATCAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364998    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_022082.3-1990s21c1
Sequence:CCGGCACACTGTAGGATGCTTAAAGCTCGAGCTTTAAGCATCCTACAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1072s1c1
Sequence:CCGGCTCTCTGATCATCTCATCAATCTCGAGATTGATGAGATGATCAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022082.2-1991s1c1
Sequence:CCGGGCACACTGTAGGATGCTTAAACTCGAGTTTAAGCATCCTACAGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1242s1c1
Sequence:CCGGCCACAGTGGCATTTCTGTTAACTCGAGTTAACAGAAATGCCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1251s1c1
Sequence:CCGGCATTTCTGTTAACATCCAGGACTCGAGTCCTGGATGTTAACAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022082.2-1245s1c1
Sequence:CCGGCAGTGGCATTTCTGTTAACATCTCGAGATGTTAACAGAAATGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183161
SLC17A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 17 (vesicular nucleotide transporter), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183161.1-725s1c1
Sequence:CCGGCCTTCCTGACATTCTCTCGAACTCGAGTTCGAGAGAATGTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-200s1c1
Sequence:CCGGTGGTATCGTGCTCAGCAGCTTCTCGAGAAGCTGCTGAGCACGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-46s1c1
Sequence:CCGGCGGCAGCAGAGGATACACGGTCTCGAGACCGTGTATCCTCTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-146s1c1
Sequence:CCGGGCCCGTCTGTACTGTTGCCATCTCGAGATGGCAACAGTACAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-89s1c1
Sequence:CCGGCTGGACAGGAATCCTGCTCCTCTCGAGAGGAGCAGGATTCCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183161
SLC17A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 17 (vesicular nucleotide transporter), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183161.1-725s1c1
Sequence:CCGGCCTTCCTGACATTCTCTCGAACTCGAGTTCGAGAGAATGTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-200s1c1
Sequence:CCGGTGGTATCGTGCTCAGCAGCTTCTCGAGAAGCTGCTGAGCACGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-46s1c1
Sequence:CCGGCGGCAGCAGAGGATACACGGTCTCGAGACCGTGTATCCTCTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-146s1c1
Sequence:CCGGGCCCGTCTGTACTGTTGCCATCTCGAGATGGCAACAGTACAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-89s1c1
Sequence:CCGGCTGGACAGGAATCCTGCTCCTCTCGAGAGGAGCAGGATTCCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183161
SLC17A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 17 (vesicular nucleotide transporter), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183161.1-725s1c1
Sequence:CCGGCCTTCCTGACATTCTCTCGAACTCGAGTTCGAGAGAATGTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-200s1c1
Sequence:CCGGTGGTATCGTGCTCAGCAGCTTCTCGAGAAGCTGCTGAGCACGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-46s1c1
Sequence:CCGGCGGCAGCAGAGGATACACGGTCTCGAGACCGTGTATCCTCTGCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-146s1c1
Sequence:CCGGGCCCGTCTGTACTGTTGCCATCTCGAGATGGCAACAGTACAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183161.1-89s1c1
Sequence:CCGGCTGGACAGGAATCCTGCTCCTCTCGAGAGGAGCAGGATTCCTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks