EMAIL THIS PAGE TO A FRIEND

SLC18A2

solute carrier family 18 (vesicular monoamine transporter), member 2

Synonyms: SVAT SVMT VAT2 VMAT2
UniProtKB ID: Q05940, B2RC96, D3DRC4, Q15876, Q5VW49, Q9H3P6
Gene ID:
Human(6571) Summary: The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]
Mouse(214084) solute carrier family 18 (vesicular monoamine), member 2
Rat(25549) solute carrier family 18 (vesicular monoamine transporter), member 2
cow(282471) solute carrier family 18 (vesicular monoamine), member 2
sheep(101104796) solute carrier family 18 (vesicular monoamine), member 2
naked mole-rat(101725597) solute carrier family 18 (vesicular monoamine), member 2
domestic guinea pig(100719098) solute carrier family 18 (vesicular monoamine), member 2
Zebrafish(553304) solute carrier family 18 (vesicular monoamine), member 2
domestic cat(101086507) solute carrier family 18 (vesicular monoamine), member 2
Horse(100058805) solute carrier family 18 (vesicular monoamine), member 2
dog(486908) solute carrier family 18 (vesicular monoamine), member 2
chicken(423921) solute carrier family 18 (vesicular monoamine), member 2
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003054 Rosetta Predictions human pricing
NM_013031 Rosetta Predictions rat pricing
NM_172523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334965 predicted 261
2 SASI_Hs01_00013341 predicted 1289
3 SASI_Hs01_00013342 predicted 269
4 SASI_Hs01_00013343 predicted 533
5 SASI_Hs02_00334966 predicted 466
6 SASI_Hs01_00013344 predicted 1466
7 SASI_Hs01_00013345 predicted 1384
8 SASI_Hs01_00013346 predicted 409
9 SASI_Hs01_00013347 predicted 1388
10 SASI_Hs01_00013348 predicted 1045
11 SASI_Hs01_00013349 predicted 660
12 SASI_Hs01_00013350 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032831 predicted 573
2 SASI_Rn01_00032832 predicted 1343
3 SASI_Rn01_00032833 predicted 1359
4 SASI_Rn01_00032836 predicted 1652
5 SASI_Rn01_00032837 predicted 1456
6 SASI_Rn02_00260723 predicted 1114
7 SASI_Rn01_00032838 predicted 1695
8 SASI_Rn02_00260724 predicted 1336
9 SASI_Rn01_00032839 predicted 1605
10 SASI_Rn01_00032840 predicted 559
11 SASI_Rn01_00032834 predicted 958
12 SASI_Rn01_00032835 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128538 predicted 819
2 SASI_Mm01_00128539 predicted 250
3 SASI_Mm01_00128541 predicted 899
4 SASI_Mm01_00128542 predicted 1657
5 SASI_Mm01_00128543 predicted 1127
6 SASI_Mm01_00128544 predicted 1736
7 SASI_Mm01_00128545 predicted 571
8 SASI_Mm02_00344121 predicted 953
9 SASI_Mm01_00128546 predicted 1466
10 SASI_Mm01_00128547 predicted 597
11 SASI_Mm01_00128540 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003054
SLC18A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 18 (vesicular monoamine transporter), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003054.3-1112s21c1
Sequence:CCGGGCTCTTCTGGGAATGATAATTCTCGAGAATTATCATTCCCAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003054.3-1483s21c1
Sequence:CCGGGGATCACAACTGCCCTATTAACTCGAGTTAATAGGGCAGTTGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-272s1c1
Sequence:CCGGCCTATTATGATAACTCGACTACTCGAGTAGTCGAGTTATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-491s1c1
Sequence:CCGGCCAACAGAATTGGCTATCCAACTCGAGTTGGATAGCCAATTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-1543s1c1
Sequence:CCGGCCGATAGGTGAAGATGAAGAACTCGAGTTCTTCATCTTCACCTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-417s1c1
Sequence:CCGGCGTGCAAGTTGGTCTGTTGTTCTCGAGAACAACAGACCAACTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-1052s1c1
Sequence:CCGGCTTATCTCATTGGAACCAATACTCGAGTATTGGTTCCAATGAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003054
SLC18A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 18 (vesicular monoamine transporter), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003054.3-1112s21c1
Sequence:CCGGGCTCTTCTGGGAATGATAATTCTCGAGAATTATCATTCCCAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003054.3-1483s21c1
Sequence:CCGGGGATCACAACTGCCCTATTAACTCGAGTTAATAGGGCAGTTGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-272s1c1
Sequence:CCGGCCTATTATGATAACTCGACTACTCGAGTAGTCGAGTTATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-491s1c1
Sequence:CCGGCCAACAGAATTGGCTATCCAACTCGAGTTGGATAGCCAATTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-1543s1c1
Sequence:CCGGCCGATAGGTGAAGATGAAGAACTCGAGTTCTTCATCTTCACCTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-417s1c1
Sequence:CCGGCGTGCAAGTTGGTCTGTTGTTCTCGAGAACAACAGACCAACTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-1052s1c1
Sequence:CCGGCTTATCTCATTGGAACCAATACTCGAGTATTGGTTCCAATGAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003054
SLC18A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 18 (vesicular monoamine transporter), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003054.3-1112s21c1
Sequence:CCGGGCTCTTCTGGGAATGATAATTCTCGAGAATTATCATTCCCAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003054.3-1483s21c1
Sequence:CCGGGGATCACAACTGCCCTATTAACTCGAGTTAATAGGGCAGTTGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-272s1c1
Sequence:CCGGCCTATTATGATAACTCGACTACTCGAGTAGTCGAGTTATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-491s1c1
Sequence:CCGGCCAACAGAATTGGCTATCCAACTCGAGTTGGATAGCCAATTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-1543s1c1
Sequence:CCGGCCGATAGGTGAAGATGAAGAACTCGAGTTCTTCATCTTCACCTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-417s1c1
Sequence:CCGGCGTGCAAGTTGGTCTGTTGTTCTCGAGAACAACAGACCAACTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003054.2-1052s1c1
Sequence:CCGGCTTATCTCATTGGAACCAATACTCGAGTATTGGTTCCAATGAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172523
SLC18A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 18 (vesicular monoamine transporter), member 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000070072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-1467s1c1
Sequence:CCGGGCTCATGACAATTATTGGGATCTCGAGATCCCAATAATTGTCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-165s1c1
Sequence:CCGGGCTGATCCTGTTCATCGTGTTCTCGAGAACACGATGAACAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172523.1-3060s1c1
Sequence:CCGGCCCTCAAATCTTATTGGCTATCTCGAGATAGCCAATAAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-1123s1c1
Sequence:CCGGGCGAGCATCTCTTATCTCATTCTCGAGAATGAGATAAGAGATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172523
SLC18A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 18 (vesicular monoamine transporter), member 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000070072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-1467s1c1
Sequence:CCGGGCTCATGACAATTATTGGGATCTCGAGATCCCAATAATTGTCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-165s1c1
Sequence:CCGGGCTGATCCTGTTCATCGTGTTCTCGAGAACACGATGAACAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172523.1-3060s1c1
Sequence:CCGGCCCTCAAATCTTATTGGCTATCTCGAGATAGCCAATAAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-1123s1c1
Sequence:CCGGGCGAGCATCTCTTATCTCATTCTCGAGAATGAGATAAGAGATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172523
SLC18A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 18 (vesicular monoamine transporter), member 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000070072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-1467s1c1
Sequence:CCGGGCTCATGACAATTATTGGGATCTCGAGATCCCAATAATTGTCATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-165s1c1
Sequence:CCGGGCTGATCCTGTTCATCGTGTTCTCGAGAACACGATGAACAGGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172523.1-3060s1c1
Sequence:CCGGCCCTCAAATCTTATTGGCTATCTCGAGATAGCCAATAAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172523.1-1123s1c1
Sequence:CCGGGCGAGCATCTCTTATCTCATTCTCGAGAATGAGATAAGAGATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks