EMAIL THIS PAGE TO A FRIEND

SLC22A18AS

solute carrier family 22 (organic cation transporter), member 18 antisense

Synonyms: BWR1B BWSCR1B ORCTL2S SLC22A1LS p27-BWR1B
Species: Human SLC22A18AS(5003)
UniProtKB ID: Q8N1D0, E9PLK8, O43563
Gene ID:
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007105 Rosetta Predictions human pricing
XR_041457 Rosetta Predictions human pricing
XR_041458 Rosetta Predictions human pricing
XR_041459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168182 predicted 683
2 SASI_Hs01_00168183 predicted 687
3 SASI_Hs01_00168184 predicted 680
4 SASI_Hs01_00168185 predicted 706
5 SASI_Hs01_00168186 predicted 683
6 SASI_Hs01_00168187 predicted 701
7 SASI_Hs01_00168188 predicted 682
8 SASI_Hs01_00168189 predicted 688
9 SASI_Hs01_00168190 predicted 681
10 SASI_Hs01_00168191 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527529 predicted 1302
2 SASI_Hs02_00527530 predicted 1228
3 SASI_Hs02_00527531 predicted 1105
4 SASI_Hs02_00527532 predicted 1099
5 SASI_Hs02_00527533 predicted 1582
6 SASI_Hs02_00527534 predicted 1272
7 SASI_Hs02_00527535 predicted 1296
8 SASI_Hs02_00527536 predicted 1140
9 SASI_Hs02_00527537 predicted 995
10 SASI_Hs02_00527538 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527539 predicted 1798
2 SASI_Hs02_00527540 predicted 1729
3 SASI_Hs02_00527541 predicted 1599
4 SASI_Hs02_00527542 predicted 1604
5 SASI_Hs02_00527543 predicted 2077
6 SASI_Hs02_00527544 predicted 1761
7 SASI_Hs02_00527545 predicted 1792
8 SASI_Hs02_00527546 predicted 1629
9 SASI_Hs02_00527547 predicted 1487
10 SASI_Hs02_00527548 predicted 1498
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527549 predicted 1300
2 SASI_Hs02_00527550 predicted 1232
3 SASI_Hs02_00527551 predicted 1103
4 SASI_Hs02_00527552 predicted 1104
5 SASI_Hs02_00527553 predicted 1585
6 SASI_Hs02_00527554 predicted 1272
7 SASI_Hs02_00527555 predicted 1295
8 SASI_Hs02_00527556 predicted 1132
9 SASI_Hs02_00527557 predicted 992
10 SASI_Hs02_00527558 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007105
SLC22A18AS MISSION shRNA Bacterial Glycerol Stock
solute carrier family 22 (organic cation transporter), member 18 antisense
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-1139s21c1
Sequence:CCGGTGTACAGCGTTCCTGACAACGCTCGAGCGTTGTCAGGAACGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-859s21c1
Sequence:CCGGGGCATTCACCGCTTCAGAGAACTCGAGTTCTCTGAAGCGGTGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-1235s21c1
Sequence:CCGGAGAATGCAAAGGCTGGTGGATCTCGAGATCCACCAGCCTTTGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-1087s1c1
Sequence:CCGGGCAAGAATGACAGGACGTGAACTCGAGTTCACGTCCTGTCATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-980s1c1
Sequence:CCGGGCCCACTTGTGTGCAAGATAACTCGAGTTATCTTGCACACAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-782s1c1
Sequence:CCGGTGATGCCTCAGCCAGTCTTAACTCGAGTTAAGACTGGCTGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-987s1c1
Sequence:CCGGTGTGTGCAAGATAACTGGAAACTCGAGTTTCCAGTTATCTTGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-558s1c1
Sequence:CCGGGAAGAAAGCAAGTGGAACCCTCTCGAGAGGGTTCCACTTGCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007105
SLC22A18AS MISSION shRNA shRNA Plasmid DNA
solute carrier family 22 (organic cation transporter), member 18 antisense
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-1139s21c1
Sequence:CCGGTGTACAGCGTTCCTGACAACGCTCGAGCGTTGTCAGGAACGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-859s21c1
Sequence:CCGGGGCATTCACCGCTTCAGAGAACTCGAGTTCTCTGAAGCGGTGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-1235s21c1
Sequence:CCGGAGAATGCAAAGGCTGGTGGATCTCGAGATCCACCAGCCTTTGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-1087s1c1
Sequence:CCGGGCAAGAATGACAGGACGTGAACTCGAGTTCACGTCCTGTCATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-980s1c1
Sequence:CCGGGCCCACTTGTGTGCAAGATAACTCGAGTTATCTTGCACACAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-782s1c1
Sequence:CCGGTGATGCCTCAGCCAGTCTTAACTCGAGTTAAGACTGGCTGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-987s1c1
Sequence:CCGGTGTGTGCAAGATAACTGGAAACTCGAGTTTCCAGTTATCTTGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-558s1c1
Sequence:CCGGGAAGAAAGCAAGTGGAACCCTCTCGAGAGGGTTCCACTTGCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007105
SLC22A18AS MISSION shRNA Lentiviral Transduction Particles
solute carrier family 22 (organic cation transporter), member 18 antisense
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-1139s21c1
Sequence:CCGGTGTACAGCGTTCCTGACAACGCTCGAGCGTTGTCAGGAACGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-859s21c1
Sequence:CCGGGGCATTCACCGCTTCAGAGAACTCGAGTTCTCTGAAGCGGTGAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007105.2-1235s21c1
Sequence:CCGGAGAATGCAAAGGCTGGTGGATCTCGAGATCCACCAGCCTTTGCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-1087s1c1
Sequence:CCGGGCAAGAATGACAGGACGTGAACTCGAGTTCACGTCCTGTCATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-980s1c1
Sequence:CCGGGCCCACTTGTGTGCAAGATAACTCGAGTTATCTTGCACACAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-782s1c1
Sequence:CCGGTGATGCCTCAGCCAGTCTTAACTCGAGTTAAGACTGGCTGAGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-987s1c1
Sequence:CCGGTGTGTGCAAGATAACTGGAAACTCGAGTTTCCAGTTATCTTGCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007105.1-558s1c1
Sequence:CCGGGAAGAAAGCAAGTGGAACCCTCTCGAGAGGGTTCCACTTGCTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks