EMAIL THIS PAGE TO A FRIEND

SLC22A9

solute carrier family 22 (organic anion transporter), member 9

Synonyms: HOAT4 OAT4 OAT7 UST3H ust3
UniProtKB ID: Q8IVM8, A0AVB7, Q8TCC8, Q8TEC0, Q8WYN7
Gene ID:
cow(508494) solute carrier family 22 (organic anion transporter), member 9
Goat(100861364) solute carrier family 22 (organic anion transporter), member 9
domestic cat(101094449) solute carrier family 22 (organic anion transporter), member 9
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080866 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128401 MISSION® esiRNA esiRNA human SLC22A9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080866 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086780 predicted 899
2 SASI_Hs01_00086781 predicted 471
3 SASI_Hs01_00086782 predicted 1635
4 SASI_Hs01_00086783 predicted 876
5 SASI_Hs01_00086784 predicted 1589
6 SASI_Hs01_00086786 predicted 911
7 SASI_Hs01_00086787 predicted 501
8 SASI_Hs01_00086788 predicted 971
9 SASI_Hs01_00086789 predicted 923
10 SASI_Hs02_00362658 predicted 697
11 SASI_Hs01_00086785 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080866
SLC22A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 22 (organic anion transporter), member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1813s1c1
Sequence:CCGGCCTTCCTGAAACCAGGAACAACTCGAGTTGTTCCTGGTTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1324s1c1
Sequence:CCGGCCTCCTGTCCTTTACGAGATTCTCGAGAATCTCGTAAAGGACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-471s1c1
Sequence:CCGGGCCAAGATGCACTCTTGAGAACTCGAGTTCTCAAGAGTGCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1535s1c1
Sequence:CCGGGCCATCATATTTGTGCCACAACTCGAGTTGTGGCACAAATATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-872s1c1
Sequence:CCGGCTACGCTTCTTGTCTGGGATTCTCGAGAATCCCAGACAAGAAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080866.2-983s21c1
Sequence:CCGGTGCCCTTCTGGTATTGCATTTCTCGAGAAATGCAATACCAGAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080866.2-896s21c1
Sequence:CCGGGCAATGAGCCTCATAACAAATCTCGAGATTTGTTATGAGGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080866
SLC22A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 22 (organic anion transporter), member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1813s1c1
Sequence:CCGGCCTTCCTGAAACCAGGAACAACTCGAGTTGTTCCTGGTTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1324s1c1
Sequence:CCGGCCTCCTGTCCTTTACGAGATTCTCGAGAATCTCGTAAAGGACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-471s1c1
Sequence:CCGGGCCAAGATGCACTCTTGAGAACTCGAGTTCTCAAGAGTGCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1535s1c1
Sequence:CCGGGCCATCATATTTGTGCCACAACTCGAGTTGTGGCACAAATATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-872s1c1
Sequence:CCGGCTACGCTTCTTGTCTGGGATTCTCGAGAATCCCAGACAAGAAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080866.2-983s21c1
Sequence:CCGGTGCCCTTCTGGTATTGCATTTCTCGAGAAATGCAATACCAGAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080866.2-896s21c1
Sequence:CCGGGCAATGAGCCTCATAACAAATCTCGAGATTTGTTATGAGGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080866
SLC22A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 22 (organic anion transporter), member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1813s1c1
Sequence:CCGGCCTTCCTGAAACCAGGAACAACTCGAGTTGTTCCTGGTTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1324s1c1
Sequence:CCGGCCTCCTGTCCTTTACGAGATTCTCGAGAATCTCGTAAAGGACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-471s1c1
Sequence:CCGGGCCAAGATGCACTCTTGAGAACTCGAGTTCTCAAGAGTGCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-1535s1c1
Sequence:CCGGGCCATCATATTTGTGCCACAACTCGAGTTGTGGCACAAATATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080866.2-872s1c1
Sequence:CCGGCTACGCTTCTTGTCTGGGATTCTCGAGAATCCCAGACAAGAAGCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080866.2-983s21c1
Sequence:CCGGTGCCCTTCTGGTATTGCATTTCTCGAGAAATGCAATACCAGAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080866.2-896s21c1
Sequence:CCGGGCAATGAGCCTCATAACAAATCTCGAGATTTGTTATGAGGCTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks