EMAIL THIS PAGE TO A FRIEND

SLC25A10

solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10

Synonyms: DIC
UniProtKB ID: Q9UBX3, Q542Z3, Q96BA1, Q96IP1
Gene ID:
Human(1468) Summary: This gene encodes a member of a family of proteins that translocate small metabolites across the mitochondrial membrane. The encoded protein exchanges dicarboxylates, such as malate and succinate, for phosphate, sulfate, and other small molecules, thereby providing substrates for metabolic processes including the Krebs cycle and fatty acid synthesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Mouse(27376) solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
Rat(170943) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
cow(100848134) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
sheep(100147800) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
naked mole-rat(101708376) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
domestic guinea pig(100732811) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Zebrafish(394147) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
chicken(769048) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
domestic cat(101099416) solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012140 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080881 MISSION® esiRNA esiRNA human SLC25A10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012140 Rosetta Predictions human pricing
NM_133418 Rosetta Predictions rat pricing
NM_013770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076693 predicted 1416
2 SASI_Hs01_00076694 predicted 644
3 SASI_Hs01_00076695 predicted 669
4 SASI_Hs01_00076696 predicted 683
5 SASI_Hs01_00076697 predicted 700
6 SASI_Hs01_00076699 predicted 1387
7 SASI_Hs01_00076701 predicted 1361
8 SASI_Hs02_00343700 predicted 682
9 SASI_Hs02_00343701 predicted 535
10 SASI_Hs02_00343702 predicted 410
11 SASI_Hs01_00076692 predicted 293
12 SASI_Hs01_00076698 predicted 315
13 SASI_Hs01_00076700 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110424 predicted 1236
2 SASI_Rn01_00110425 predicted 500
3 SASI_Rn01_00110426 predicted 1350
4 SASI_Rn01_00110428 predicted 218
5 SASI_Rn02_00267675 predicted 1310
6 SASI_Rn01_00110429 predicted 1118
7 SASI_Rn01_00110430 predicted 1352
8 SASI_Rn01_00110431 predicted 273
9 SASI_Rn01_00110432 predicted 478
10 SASI_Rn01_00110433 predicted 378
11 SASI_Rn01_00110427 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083405 predicted 321
2 SASI_Mm01_00083406 predicted 1433
3 SASI_Mm01_00083407 predicted 338
4 SASI_Mm01_00083408 predicted 1427
5 SASI_Mm01_00083409 predicted 299
6 SASI_Mm01_00083410 predicted 363
7 SASI_Mm01_00083411 predicted 591
8 SASI_Mm01_00083412 predicted 695
9 SASI_Mm01_00083413 predicted 1297
10 SASI_Mm01_00083414 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013770
SLC25A10 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013770.1-1209s1c1
Sequence:CCGGCCGTCTTCCTATCCGATGATTCTCGAGAATCATCGGATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-950s1c1
Sequence:CCGGCGGAAGCACTTTGGCATCAAACTCGAGTTTGATGCCAAAGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-442s1c1
Sequence:CCGGCAGTGGTTTAACTGGAGGCTTCTCGAGAAGCCTCCAGTTAAACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-352s1c1
Sequence:CCGGGTTCGCAATCTACGAGACCATCTCGAGATGGTCTCGTAGATTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-707s1c1
Sequence:CCGGGACAACATATTCACCCACTTTCTCGAGAAAGTGGGTGAATATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.2-812s21c1
Sequence:CCGGTGCTGAAGACTCGCCTGATGACTCGAGTCATCAGGCGAGTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-352s21c2
Sequence:CCGGGTTCGCAATCTACGAGACCATCTCGAGATGGTCTCGTAGATTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.2-727s21c1
Sequence:CCGGTACCTGAGTGACAACATATTCCTCGAGGAATATGTTGTCACTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-950s21c1
Sequence:CCGGCGGAAGCACTTTGGCATCAAACTCGAGTTTGATGCCAAAGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-527s21c1
Sequence:CCGGCAACGACGCAACTACTCTCATCTCGAGATGAGAGTAGTTGCGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-230s21c1
Sequence:CCGGCAGGAGGTGAAGCTTCGAATGCTCGAGCATTCGAAGCTTCACCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013770.1-1209s21c3
Sequence:CCGGCCGTCTTCCTATCCGATGATTCTCGAGAATCATCGGATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013770
SLC25A10 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013770.1-1209s1c1
Sequence:CCGGCCGTCTTCCTATCCGATGATTCTCGAGAATCATCGGATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-950s1c1
Sequence:CCGGCGGAAGCACTTTGGCATCAAACTCGAGTTTGATGCCAAAGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-442s1c1
Sequence:CCGGCAGTGGTTTAACTGGAGGCTTCTCGAGAAGCCTCCAGTTAAACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-352s1c1
Sequence:CCGGGTTCGCAATCTACGAGACCATCTCGAGATGGTCTCGTAGATTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-707s1c1
Sequence:CCGGGACAACATATTCACCCACTTTCTCGAGAAAGTGGGTGAATATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.2-812s21c1
Sequence:CCGGTGCTGAAGACTCGCCTGATGACTCGAGTCATCAGGCGAGTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-352s21c2
Sequence:CCGGGTTCGCAATCTACGAGACCATCTCGAGATGGTCTCGTAGATTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.2-727s21c1
Sequence:CCGGTACCTGAGTGACAACATATTCCTCGAGGAATATGTTGTCACTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-950s21c1
Sequence:CCGGCGGAAGCACTTTGGCATCAAACTCGAGTTTGATGCCAAAGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-527s21c1
Sequence:CCGGCAACGACGCAACTACTCTCATCTCGAGATGAGAGTAGTTGCGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-230s21c1
Sequence:CCGGCAGGAGGTGAAGCTTCGAATGCTCGAGCATTCGAAGCTTCACCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013770.1-1209s21c3
Sequence:CCGGCCGTCTTCCTATCCGATGATTCTCGAGAATCATCGGATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013770
SLC25A10 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013770.1-1209s1c1
Sequence:CCGGCCGTCTTCCTATCCGATGATTCTCGAGAATCATCGGATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-950s1c1
Sequence:CCGGCGGAAGCACTTTGGCATCAAACTCGAGTTTGATGCCAAAGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-442s1c1
Sequence:CCGGCAGTGGTTTAACTGGAGGCTTCTCGAGAAGCCTCCAGTTAAACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-352s1c1
Sequence:CCGGGTTCGCAATCTACGAGACCATCTCGAGATGGTCTCGTAGATTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013770.1-707s1c1
Sequence:CCGGGACAACATATTCACCCACTTTCTCGAGAAAGTGGGTGAATATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.2-812s21c1
Sequence:CCGGTGCTGAAGACTCGCCTGATGACTCGAGTCATCAGGCGAGTCTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-352s21c2
Sequence:CCGGGTTCGCAATCTACGAGACCATCTCGAGATGGTCTCGTAGATTGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.2-727s21c1
Sequence:CCGGTACCTGAGTGACAACATATTCCTCGAGGAATATGTTGTCACTCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-950s21c1
Sequence:CCGGCGGAAGCACTTTGGCATCAAACTCGAGTTTGATGCCAAAGTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-527s21c1
Sequence:CCGGCAACGACGCAACTACTCTCATCTCGAGATGAGAGTAGTTGCGTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013770.1-230s21c1
Sequence:CCGGCAGGAGGTGAAGCTTCGAATGCTCGAGCATTCGAAGCTTCACCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013770.1-1209s21c3
Sequence:CCGGCCGTCTTCCTATCCGATGATTCTCGAGAATCATCGGATAGGAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012140
SLC25A10 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-700s1c1
Sequence:CCGGCCAGCTTTATTGCAGGTGGATCTCGAGATCCACCTGCAATAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-311s1c1
Sequence:CCGGCCTGACTCGGTTCGCCATCTACTCGAGTAGATGGCGAACCGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-446s1c1
Sequence:CCGGAGACTTGGTCAACGTCAGGATCTCGAGATCCTGACGTTGACCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-752s1c1
Sequence:CCGGGCTGAAGACTCGCCTGATGAACTCGAGTTCATCAGGCGAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012140.3-1385s21c1
Sequence:CCGGTGCTAGCTCTGCACTTCGTGTCTCGAGACACGAAGTGCAGAGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012140.3-676s21c1
Sequence:CCGGACAACATCTTCACTCACTTTGCTCGAGCAAAGTGAGTGAAGATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012140
SLC25A10 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-700s1c1
Sequence:CCGGCCAGCTTTATTGCAGGTGGATCTCGAGATCCACCTGCAATAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-311s1c1
Sequence:CCGGCCTGACTCGGTTCGCCATCTACTCGAGTAGATGGCGAACCGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-446s1c1
Sequence:CCGGAGACTTGGTCAACGTCAGGATCTCGAGATCCTGACGTTGACCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-752s1c1
Sequence:CCGGGCTGAAGACTCGCCTGATGAACTCGAGTTCATCAGGCGAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012140.3-1385s21c1
Sequence:CCGGTGCTAGCTCTGCACTTCGTGTCTCGAGACACGAAGTGCAGAGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012140.3-676s21c1
Sequence:CCGGACAACATCTTCACTCACTTTGCTCGAGCAAAGTGAGTGAAGATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012140
SLC25A10 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-700s1c1
Sequence:CCGGCCAGCTTTATTGCAGGTGGATCTCGAGATCCACCTGCAATAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-311s1c1
Sequence:CCGGCCTGACTCGGTTCGCCATCTACTCGAGTAGATGGCGAACCGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-446s1c1
Sequence:CCGGAGACTTGGTCAACGTCAGGATCTCGAGATCCTGACGTTGACCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012140.3-752s1c1
Sequence:CCGGGCTGAAGACTCGCCTGATGAACTCGAGTTCATCAGGCGAGTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012140.3-1385s21c1
Sequence:CCGGTGCTAGCTCTGCACTTCGTGTCTCGAGACACGAAGTGCAGAGCTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012140.3-676s21c1
Sequence:CCGGACAACATCTTCACTCACTTTGCTCGAGCAAAGTGAGTGAAGATGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks