EMAIL THIS PAGE TO A FRIEND

SLC25A11

solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11

Synonyms: OGC SLC20A4
UniProtKB ID: Q02978, F5GY65, O75537, Q969P7
Gene ID:
Human(8402) Summary: The oxoglutarate/malate carrier transports 2-oxoglutarate across the inner membranes of mitochondria in an electroneutral exchange for malate or other dicarboxylic acids (summary by Iacobazzi et al., 1992 [PubMed 1457818]
Mouse(67863) solute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Rat(64201) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Zebrafish(415189) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
dog(479470) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
domestic cat(101091570) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
domestic guinea pig(100722970) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
naked mole-rat(101717469) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
cow(282523) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
sheep(100147782) solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102182 Anti-SLC25A11 (ab1) antibody produced in rabbit affinity isolated antibody canine, zebrafish, human, rat, sheep, guinea pig, rabbit, mouse, horse, bovine
western blot pricing
SAB2102183 Anti-SLC25A11 (ab2) antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, horse, bovine, zebrafish, mouse, rat, sheep, canine
western blot pricing
HPA021167 Anti-SLC25A11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0008402M1 Monoclonal Anti-SLC25A11 antibody produced in mouse clone 3G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003562 Rosetta Predictions human pricing
NM_022398 Rosetta Predictions rat pricing
NM_024211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011316 predicted 390
2 SASI_Hs01_00011317 predicted 576
3 SASI_Hs01_00011318 predicted 272
4 SASI_Hs01_00011319 predicted 745
5 SASI_Hs01_00011320 predicted 407
6 SASI_Hs01_00011321 predicted 743
7 SASI_Hs01_00011322 predicted 759
8 SASI_Hs01_00011323 predicted 726
9 SASI_Hs01_00011324 predicted 595
10 SASI_Hs02_00335860 predicted 1162
11 SASI_Hs01_00011325 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263167 predicted 416
2 SASI_Rn01_00076339 predicted 491
3 SASI_Rn01_00076340 predicted 630
4 SASI_Rn01_00076342 predicted 490
5 SASI_Rn01_00076343 predicted 461
6 SASI_Rn01_00076344 predicted 420
7 SASI_Rn01_00076345 predicted 368
8 SASI_Rn01_00076346 predicted 610
9 SASI_Rn01_00076347 predicted 433
10 SASI_Rn01_00076348 predicted 599
11 SASI_Rn01_00076341 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193621 predicted 864
2 SASI_Mm01_00193622 predicted 615
3 SASI_Mm01_00193623 predicted 415
4 SASI_Mm01_00193624 predicted 431
5 SASI_Mm01_00193625 predicted 766
6 SASI_Mm01_00193626 predicted 419
7 SASI_Mm01_00193627 predicted 793
8 SASI_Mm01_00193628 predicted 1119
9 SASI_Mm01_00193629 predicted 721
10 SASI_Mm02_00327571 predicted 358
11 SASI_Mm01_00193620 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003562
VALIDATED
SLC25A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-869s21c1
Sequence:CCGGGATTGATGGGAAGCCGGAATACTCGAGTATTCCGGCTTCCCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-1164s21c1
Sequence:CCGGGGTTTCTTCCTCTGCGGTAAACTCGAGTTTACCGCAGAGGAAGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-721s21c1
Sequence:CCGGCCCAATCCAAGCAGTTCTTACCTCGAGGTAAGAACTGCTTGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-401s21c1
Sequence:CCGGTACCCGCCTTGGCATCTATACCTCGAGGTATAGATGCCAAGGCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-1016s21c1
Sequence:CCGGGCAGATGAACAAGGCCTACAACTCGAGTTGTAGGCCTTGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-716s1c1
Sequence:CCGGCTACTCCCAATCCAAGCAGTTCTCGAGAACTGCTTGGATTGGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003562.3-1016s1c1
Sequence:CCGGGCAGATGAACAAGGCCTACAACTCGAGTTGTAGGCCTTGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003562.3-786s1c1
Sequence:CCGGGCCAGCATGATCAGCGGTCTTCTCGAGAAGACCGCTGATCATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-410s1c1
Sequence:CCGGTGGCATCTATACCGTGCTGTTCTCGAGAACAGCACGGTATAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-908s1c1
Sequence:CCGGGCTGTTCAAAGTTGTCCGCTACTCGAGTAGCGGACAACTTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003562
VALIDATED
SLC25A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-869s21c1
Sequence:CCGGGATTGATGGGAAGCCGGAATACTCGAGTATTCCGGCTTCCCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-1164s21c1
Sequence:CCGGGGTTTCTTCCTCTGCGGTAAACTCGAGTTTACCGCAGAGGAAGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-721s21c1
Sequence:CCGGCCCAATCCAAGCAGTTCTTACCTCGAGGTAAGAACTGCTTGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-401s21c1
Sequence:CCGGTACCCGCCTTGGCATCTATACCTCGAGGTATAGATGCCAAGGCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-1016s21c1
Sequence:CCGGGCAGATGAACAAGGCCTACAACTCGAGTTGTAGGCCTTGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-716s1c1
Sequence:CCGGCTACTCCCAATCCAAGCAGTTCTCGAGAACTGCTTGGATTGGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003562.3-1016s1c1
Sequence:CCGGGCAGATGAACAAGGCCTACAACTCGAGTTGTAGGCCTTGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003562.3-786s1c1
Sequence:CCGGGCCAGCATGATCAGCGGTCTTCTCGAGAAGACCGCTGATCATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-410s1c1
Sequence:CCGGTGGCATCTATACCGTGCTGTTCTCGAGAACAGCACGGTATAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-908s1c1
Sequence:CCGGGCTGTTCAAAGTTGTCCGCTACTCGAGTAGCGGACAACTTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003562
VALIDATED
SLC25A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-869s21c1
Sequence:CCGGGATTGATGGGAAGCCGGAATACTCGAGTATTCCGGCTTCCCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322739    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-1164s21c1
Sequence:CCGGGGTTTCTTCCTCTGCGGTAAACTCGAGTTTACCGCAGAGGAAGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-721s21c1
Sequence:CCGGCCCAATCCAAGCAGTTCTTACCTCGAGGTAAGAACTGCTTGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-401s21c1
Sequence:CCGGTACCCGCCTTGGCATCTATACCTCGAGGTATAGATGCCAAGGCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003562.3-1016s21c1
Sequence:CCGGGCAGATGAACAAGGCCTACAACTCGAGTTGTAGGCCTTGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-716s1c1
Sequence:CCGGCTACTCCCAATCCAAGCAGTTCTCGAGAACTGCTTGGATTGGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003562.3-1016s1c1
Sequence:CCGGGCAGATGAACAAGGCCTACAACTCGAGTTGTAGGCCTTGTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003562.3-786s1c1
Sequence:CCGGGCCAGCATGATCAGCGGTCTTCTCGAGAAGACCGCTGATCATGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-410s1c1
Sequence:CCGGTGGCATCTATACCGTGCTGTTCTCGAGAACAGCACGGTATAGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003562.3-908s1c1
Sequence:CCGGGCTGTTCAAAGTTGTCCGCTACTCGAGTAGCGGACAACTTTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024211
VALIDATED
SLC25A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-737s21c1
Sequence:CCGGCTCTCAATCTAAGCAGTTCTTCTCGAGAAGAACTGCTTAGATTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024211.2-1168s21c1
Sequence:CCGGCCTGGGCTATTCTATTTATTTCTCGAGAAATAAATAGAATAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-273s21c1
Sequence:CCGGCGGATGCAGTTGAGTGGTGAACTCGAGTTCACCACTCAACTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-869s21c1
Sequence:CCGGGATCCAGAATATGCGGATGATCTCGAGATCATCCGCATATTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-968s21c1
Sequence:CCGGGAAGGGCTTCACACCATACTACTCGAGTAGTATGGTGTGAAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-1168s1c1
Sequence:CCGGCCTGGGCTATTCTATTTATTTCTCGAGAAATAAATAGAATAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024211.2-968s1c1
Sequence:CCGGGAAGGGCTTCACACCATACTACTCGAGTAGTATGGTGTGAAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-273s1c1
Sequence:CCGGCGGATGCAGTTGAGTGGTGAACTCGAGTTCACCACTCAACTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-869s1c1
Sequence:CCGGGATCCAGAATATGCGGATGATCTCGAGATCATCCGCATATTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-737s1c1
Sequence:CCGGCTCTCAATCTAAGCAGTTCTTCTCGAGAAGAACTGCTTAGATTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024211
VALIDATED
SLC25A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-737s21c1
Sequence:CCGGCTCTCAATCTAAGCAGTTCTTCTCGAGAAGAACTGCTTAGATTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024211.2-1168s21c1
Sequence:CCGGCCTGGGCTATTCTATTTATTTCTCGAGAAATAAATAGAATAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-273s21c1
Sequence:CCGGCGGATGCAGTTGAGTGGTGAACTCGAGTTCACCACTCAACTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-869s21c1
Sequence:CCGGGATCCAGAATATGCGGATGATCTCGAGATCATCCGCATATTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-968s21c1
Sequence:CCGGGAAGGGCTTCACACCATACTACTCGAGTAGTATGGTGTGAAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-1168s1c1
Sequence:CCGGCCTGGGCTATTCTATTTATTTCTCGAGAAATAAATAGAATAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024211.2-968s1c1
Sequence:CCGGGAAGGGCTTCACACCATACTACTCGAGTAGTATGGTGTGAAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-273s1c1
Sequence:CCGGCGGATGCAGTTGAGTGGTGAACTCGAGTTCACCACTCAACTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-869s1c1
Sequence:CCGGGATCCAGAATATGCGGATGATCTCGAGATCATCCGCATATTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-737s1c1
Sequence:CCGGCTCTCAATCTAAGCAGTTCTTCTCGAGAAGAACTGCTTAGATTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024211
VALIDATED
SLC25A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-737s21c1
Sequence:CCGGCTCTCAATCTAAGCAGTTCTTCTCGAGAAGAACTGCTTAGATTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316110    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024211.2-1168s21c1
Sequence:CCGGCCTGGGCTATTCTATTTATTTCTCGAGAAATAAATAGAATAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-273s21c1
Sequence:CCGGCGGATGCAGTTGAGTGGTGAACTCGAGTTCACCACTCAACTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-869s21c1
Sequence:CCGGGATCCAGAATATGCGGATGATCTCGAGATCATCCGCATATTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024211.2-968s21c1
Sequence:CCGGGAAGGGCTTCACACCATACTACTCGAGTAGTATGGTGTGAAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-1168s1c1
Sequence:CCGGCCTGGGCTATTCTATTTATTTCTCGAGAAATAAATAGAATAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024211.2-968s1c1
Sequence:CCGGGAAGGGCTTCACACCATACTACTCGAGTAGTATGGTGTGAAGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-273s1c1
Sequence:CCGGCGGATGCAGTTGAGTGGTGAACTCGAGTTCACCACTCAACTGCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-869s1c1
Sequence:CCGGGATCCAGAATATGCGGATGATCTCGAGATCATCCGCATATTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024211.2-737s1c1
Sequence:CCGGCTCTCAATCTAAGCAGTTCTTCTCGAGAAGAACTGCTTAGATTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks