EMAIL THIS PAGE TO A FRIEND

SLC25A17

solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17

Synonyms: PMP34
UniProtKB ID: O43808, A8KA59, Q5TFL0, Q9UGW8, Q9UGY7
Gene ID:
Human(10478) Summary: This gene encodes a peroxisomal membrane protein that belongs to the family of mitochondrial solute carriers. It is expressed in the liver, and is likely involved in transport. [provided by RefSeq, Sep 2011]
Mouse(20524) solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
Rat(300083) solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
naked mole-rat(101713920) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
domestic guinea pig(100714208) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
cow(506631) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
sheep(100147783) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Zebrafish(100093708) solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17
chicken(418004) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
dog(474498) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
domestic cat(101086579) solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006358 siRNAs that have been validated in the lab human pricing
NM_001126269 Rosetta Predictions rat pricing
NM_011399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006358 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137111 validated 647
2 SASI_Hs01_00137112 predicted 508
3 SASI_Hs01_00137113 predicted 829
4 SASI_Hs01_00137114 predicted 613
5 SASI_Hs01_00137115 predicted 396
6 SASI_Hs01_00137116 predicted 566
7 SASI_Hs01_00137117 predicted 916
8 SASI_Hs01_00137118 predicted 470
9 SASI_Hs01_00137119 predicted 461
10 SASI_Hs01_00137120 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126269 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253063 predicted 902
2 SASI_Rn02_00253064 predicted 511
3 SASI_Rn02_00253065 predicted 536
4 SASI_Rn02_00253066 predicted 537
5 SASI_Rn02_00253067 predicted 1124
6 SASI_Rn02_00253068 predicted 206
7 SASI_Rn02_00253069 predicted 1134
8 SASI_Rn02_00253070 predicted 804
9 SASI_Rn02_00253071 predicted 640
10 SASI_Rn02_00253072 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149743 predicted 1053
2 SASI_Mm01_00149744 predicted 293
3 SASI_Mm01_00149747 predicted 443
4 SASI_Mm01_00149748 predicted 400
5 SASI_Mm02_00320607 predicted 616
6 SASI_Mm01_00149749 predicted 1045
7 SASI_Mm01_00149750 predicted 458
8 SASI_Mm01_00149751 predicted 643
9 SASI_Mm01_00149752 predicted 658
10 SASI_Mm02_00320608 predicted 557
11 SASI_Mm01_00149745 predicted 817
12 SASI_Mm01_00149746 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006358
VALIDATED
SLC25A17 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006358.2-1315s21c1
Sequence:CCGGATGAAAGTTTGTGAGTGTTTACTCGAGTAAACACTCACAAACTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006358.2-571s21c1
Sequence:CCGGCAAACTACAAAGGTATCATTGCTCGAGCAATGATACCTTTGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006358.2-984s1c1
Sequence:CCGGGCTCTCATGTTCCTTGTTTATCTCGAGATAAACAAGGAACATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006358.2-614s1c1
Sequence:CCGGCGATGAAGGAATCTCGGCTTTCTCGAGAAAGCCGAGATTCCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006358.2-840s1c1
Sequence:CCGGCGTCATAGACTAAACCCAGAACTCGAGTTCTGGGTTTAGTCTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006358.2-753s1c1
Sequence:CCGGGTGTTCATCATTGGTGCAGTACTCGAGTACTGCACCAATGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006358
VALIDATED
SLC25A17 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006358.2-1315s21c1
Sequence:CCGGATGAAAGTTTGTGAGTGTTTACTCGAGTAAACACTCACAAACTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006358.2-571s21c1
Sequence:CCGGCAAACTACAAAGGTATCATTGCTCGAGCAATGATACCTTTGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006358.2-984s1c1
Sequence:CCGGGCTCTCATGTTCCTTGTTTATCTCGAGATAAACAAGGAACATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006358.2-614s1c1
Sequence:CCGGCGATGAAGGAATCTCGGCTTTCTCGAGAAAGCCGAGATTCCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006358.2-840s1c1
Sequence:CCGGCGTCATAGACTAAACCCAGAACTCGAGTTCTGGGTTTAGTCTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006358.2-753s1c1
Sequence:CCGGGTGTTCATCATTGGTGCAGTACTCGAGTACTGCACCAATGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006358
VALIDATED
SLC25A17 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006358.2-1315s21c1
Sequence:CCGGATGAAAGTTTGTGAGTGTTTACTCGAGTAAACACTCACAAACTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006358.2-571s21c1
Sequence:CCGGCAAACTACAAAGGTATCATTGCTCGAGCAATGATACCTTTGTAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006358.2-984s1c1
Sequence:CCGGGCTCTCATGTTCCTTGTTTATCTCGAGATAAACAAGGAACATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006358.2-614s1c1
Sequence:CCGGCGATGAAGGAATCTCGGCTTTCTCGAGAAAGCCGAGATTCCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006358.2-840s1c1
Sequence:CCGGCGTCATAGACTAAACCCAGAACTCGAGTTCTGGGTTTAGTCTATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_006358.2-753s1c1
Sequence:CCGGGTGTTCATCATTGGTGCAGTACTCGAGTACTGCACCAATGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011399
VALIDATED
SLC25A17 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000068543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011399.1-1442s1c1
Sequence:CCGGCCTGCTTTAAGAAAGCTATTTCTCGAGAAATAGCTTTCTTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011399.1-574s1c1
Sequence:CCGGGCCATCCAATTCATGTTCTATCTCGAGATAGAACATGAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011399.1-463s1c1
Sequence:CCGGCCAACTAACTACAAAGGCATTCTCGAGAATGCCTTTGTAGTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011399.1-612s1c1
Sequence:CCGGGCTTCTAAAGAAACGGATGAACTCGAGTTCATCCGTTTCTTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011399
VALIDATED
SLC25A17 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000068543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011399.1-1442s1c1
Sequence:CCGGCCTGCTTTAAGAAAGCTATTTCTCGAGAAATAGCTTTCTTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011399.1-574s1c1
Sequence:CCGGGCCATCCAATTCATGTTCTATCTCGAGATAGAACATGAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011399.1-463s1c1
Sequence:CCGGCCAACTAACTACAAAGGCATTCTCGAGAATGCCTTTGTAGTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011399.1-612s1c1
Sequence:CCGGGCTTCTAAAGAAACGGATGAACTCGAGTTCATCCGTTTCTTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011399
VALIDATED
SLC25A17 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000068543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011399.1-1442s1c1
Sequence:CCGGCCTGCTTTAAGAAAGCTATTTCTCGAGAAATAGCTTTCTTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011399.1-574s1c1
Sequence:CCGGGCCATCCAATTCATGTTCTATCTCGAGATAGAACATGAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011399.1-463s1c1
Sequence:CCGGCCAACTAACTACAAAGGCATTCTCGAGAATGCCTTTGTAGTTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011399.1-612s1c1
Sequence:CCGGGCTTCTAAAGAAACGGATGAACTCGAGTTCATCCGTTTCTTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks