EMAIL THIS PAGE TO A FRIEND

SLC25A1

solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1

Synonyms: CTP D2L2AD SEA SLC20A3
UniProtKB ID: P53007, A8K8E8, Q9BSK6
Gene ID:
Human(6576) Summary: The mitochondrial tricarboxylate transporter (also called citrate transport protein, or CTP) is responsible for the movement of citrate across the mitochondrial inner membrane (Kaplan et al., 1993 [PubMed 8514800]
Mouse(13358) solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
Rat(29743) solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1
chicken(416764) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
dog(608348) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
domestic cat(101081502) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
domestic guinea pig(100726986) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
naked mole-rat(101723635) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
cow(282476) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
sheep(101120358) solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005984 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033301 MISSION® esiRNA esiRNA targeting mouse Slc25a1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005984 Rosetta Predictions human pricing
NM_017307 Rosetta Predictions rat pricing
NM_153150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340673 predicted 1072
2 SASI_Hs01_00163097 predicted 795
3 SASI_Hs02_00340674 predicted 962
4 SASI_Hs01_00163099 predicted 673
5 SASI_Hs01_00163100 predicted 694
6 SASI_Hs01_00163101 predicted 599
7 SASI_Hs01_00163102 predicted 1019
8 SASI_Hs01_00163103 predicted 1083
9 SASI_Hs02_00340675 predicted 909
10 SASI_Hs01_00163096 predicted 354
11 SASI_Hs01_00163098 predicted 358
12 SASI_Hs01_00163104 predicted 396
13 SASI_Hs01_00163105 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120045 predicted 980
2 SASI_Rn01_00120046 predicted 1311
3 SASI_Rn01_00120047 predicted 1211
4 SASI_Rn01_00120048 predicted 687
5 SASI_Rn01_00120049 predicted 1166
6 SASI_Rn01_00120050 predicted 1087
7 SASI_Rn02_00261754 predicted 1204
8 SASI_Rn01_00120051 predicted 234
9 SASI_Rn01_00120052 predicted 760
10 SASI_Rn01_00120053 predicted 1396
11 SASI_Rn01_00120054 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122052 predicted 1256
2 SASI_Mm01_00122053 predicted 1265
3 SASI_Mm01_00122054 predicted 618
4 SASI_Mm01_00122055 predicted 748
5 SASI_Mm01_00122056 predicted 675
6 SASI_Mm01_00122057 predicted 807
7 SASI_Mm01_00122058 predicted 634
8 SASI_Mm01_00122059 predicted 516
9 SASI_Mm01_00122060 predicted 1094
10 SASI_Mm01_00122061 predicted 600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005984
VALIDATED
SLC25A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-590s21c1
Sequence:CCGGCCCAAGTACAGAGGATTCTTCCTCGAGGAAGAATCCTCTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-1074s21c1
Sequence:CCGGCAGAGTGTCCTGCTACCTTTGCTCGAGCAAAGGTAGCAGGACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-962s21c1
Sequence:CCGGTGGATGTGGCCATAGTGTTTGCTCGAGCAAACACTATGGCCACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.1-911s21c1
Sequence:CCGGGGCTCAAGGCATTCTACAAAGCTCGAGCTTTGTAGAATGCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-812s21c1
Sequence:CCGGACACTCCTCTGGATGTGATTACTCGAGTAATCACATCCAGAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-686s21c1
Sequence:CCGGCCATCCGCTTCTTCGTCATGACTCGAGTCATGACGAAGAAGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.2-870s21c1
Sequence:CCGGAGGCGCACAAATACCGGAACACTCGAGTGTTCCGGTATTTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-762s21c1
Sequence:CCGGAGCCCATGAACCCTCTGATCACTCGAGTGATCAGAGGGTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-223s21c1
Sequence:CCGGTGGCATCGAGATCTGCATCACCTCGAGGTGATGCAGATCTCGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-926s21c1
Sequence:CCGGGGGCTCAAGGCATTCTACAAGCTCGAGCTTGTAGAATGCCTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-970s1c1
Sequence:CCGGGCCATAGTGTTTGTCATCTATCTCGAGATAGATGACAAACACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-399s1c1
Sequence:CCGGCAGGTTTGGAATGTTCGAGTTCTCGAGAACTCGAACATTCCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-1005s1c1
Sequence:CCGGGCTGCTCAACAAAGTGTGGAACTCGAGTTCCACACTTTGTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-812s1c1
Sequence:CCGGACACTCCTCTGGATGTGATTACTCGAGTAATCACATCCAGAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-354s1c1
Sequence:CCGGCGGCCTTAGCTCCCTGCTCTACTCGAGTAGAGCAGGGAGCTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005984
VALIDATED
SLC25A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-590s21c1
Sequence:CCGGCCCAAGTACAGAGGATTCTTCCTCGAGGAAGAATCCTCTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-1074s21c1
Sequence:CCGGCAGAGTGTCCTGCTACCTTTGCTCGAGCAAAGGTAGCAGGACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-962s21c1
Sequence:CCGGTGGATGTGGCCATAGTGTTTGCTCGAGCAAACACTATGGCCACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.1-911s21c1
Sequence:CCGGGGCTCAAGGCATTCTACAAAGCTCGAGCTTTGTAGAATGCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-812s21c1
Sequence:CCGGACACTCCTCTGGATGTGATTACTCGAGTAATCACATCCAGAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-686s21c1
Sequence:CCGGCCATCCGCTTCTTCGTCATGACTCGAGTCATGACGAAGAAGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.2-870s21c1
Sequence:CCGGAGGCGCACAAATACCGGAACACTCGAGTGTTCCGGTATTTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-762s21c1
Sequence:CCGGAGCCCATGAACCCTCTGATCACTCGAGTGATCAGAGGGTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-223s21c1
Sequence:CCGGTGGCATCGAGATCTGCATCACCTCGAGGTGATGCAGATCTCGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-926s21c1
Sequence:CCGGGGGCTCAAGGCATTCTACAAGCTCGAGCTTGTAGAATGCCTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-970s1c1
Sequence:CCGGGCCATAGTGTTTGTCATCTATCTCGAGATAGATGACAAACACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-399s1c1
Sequence:CCGGCAGGTTTGGAATGTTCGAGTTCTCGAGAACTCGAACATTCCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-1005s1c1
Sequence:CCGGGCTGCTCAACAAAGTGTGGAACTCGAGTTCCACACTTTGTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-812s1c1
Sequence:CCGGACACTCCTCTGGATGTGATTACTCGAGTAATCACATCCAGAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-354s1c1
Sequence:CCGGCGGCCTTAGCTCCCTGCTCTACTCGAGTAGAGCAGGGAGCTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005984
VALIDATED
SLC25A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-590s21c1
Sequence:CCGGCCCAAGTACAGAGGATTCTTCCTCGAGGAAGAATCCTCTGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232829    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-1074s21c1
Sequence:CCGGCAGAGTGTCCTGCTACCTTTGCTCGAGCAAAGGTAGCAGGACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-962s21c1
Sequence:CCGGTGGATGTGGCCATAGTGTTTGCTCGAGCAAACACTATGGCCACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.1-911s21c1
Sequence:CCGGGGCTCAAGGCATTCTACAAAGCTCGAGCTTTGTAGAATGCCTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-812s21c1
Sequence:CCGGACACTCCTCTGGATGTGATTACTCGAGTAATCACATCCAGAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.1-686s21c1
Sequence:CCGGCCATCCGCTTCTTCGTCATGACTCGAGTCATGACGAAGAAGCGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005984.2-870s21c1
Sequence:CCGGAGGCGCACAAATACCGGAACACTCGAGTGTTCCGGTATTTGTGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-762s21c1
Sequence:CCGGAGCCCATGAACCCTCTGATCACTCGAGTGATCAGAGGGTTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-223s21c1
Sequence:CCGGTGGCATCGAGATCTGCATCACCTCGAGGTGATGCAGATCTCGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005984.2-926s21c1
Sequence:CCGGGGGCTCAAGGCATTCTACAAGCTCGAGCTTGTAGAATGCCTTGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-970s1c1
Sequence:CCGGGCCATAGTGTTTGTCATCTATCTCGAGATAGATGACAAACACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-399s1c1
Sequence:CCGGCAGGTTTGGAATGTTCGAGTTCTCGAGAACTCGAACATTCCAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-1005s1c1
Sequence:CCGGGCTGCTCAACAAAGTGTGGAACTCGAGTTCCACACTTTGTTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-812s1c1
Sequence:CCGGACACTCCTCTGGATGTGATTACTCGAGTAATCACATCCAGAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005984.1-354s1c1
Sequence:CCGGCGGCCTTAGCTCCCTGCTCTACTCGAGTAGAGCAGGGAGCTAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153150
VALIDATED
SLC25A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153150.1-1258s1c1
Sequence:CCGGCCTGTGAATATGTGCTCACTTCTCGAGAAGTGAGCACATATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153150.1-883s1c1
Sequence:CCGGCTGCGGCTTGAAGATCCTAAACTCGAGTTTAGGATCTTCAAGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-685s1c1
Sequence:CCGGAGCCATCCGATTCTTTGTCATCTCGAGATGACAAAGAATCGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-211s1c1
Sequence:CCGGCATCGAAATCTGCATCACCTTCTCGAGAAGGTGATGCAGATTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-977s1c1
Sequence:CCGGGTATTCATCATCTACGATGAACTCGAGTTCATCGTAGATGATGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153150
VALIDATED
SLC25A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153150.1-1258s1c1
Sequence:CCGGCCTGTGAATATGTGCTCACTTCTCGAGAAGTGAGCACATATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153150.1-883s1c1
Sequence:CCGGCTGCGGCTTGAAGATCCTAAACTCGAGTTTAGGATCTTCAAGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-685s1c1
Sequence:CCGGAGCCATCCGATTCTTTGTCATCTCGAGATGACAAAGAATCGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-211s1c1
Sequence:CCGGCATCGAAATCTGCATCACCTTCTCGAGAAGGTGATGCAGATTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-977s1c1
Sequence:CCGGGTATTCATCATCTACGATGAACTCGAGTTCATCGTAGATGATGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153150
VALIDATED
SLC25A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153150.1-1258s1c1
Sequence:CCGGCCTGTGAATATGTGCTCACTTCTCGAGAAGTGAGCACATATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153150.1-883s1c1
Sequence:CCGGCTGCGGCTTGAAGATCCTAAACTCGAGTTTAGGATCTTCAAGCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-685s1c1
Sequence:CCGGAGCCATCCGATTCTTTGTCATCTCGAGATGACAAAGAATCGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-211s1c1
Sequence:CCGGCATCGAAATCTGCATCACCTTCTCGAGAAGGTGATGCAGATTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153150.1-977s1c1
Sequence:CCGGGTATTCATCATCTACGATGAACTCGAGTTCATCGTAGATGATGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks