EMAIL THIS PAGE TO A FRIEND

SLC25A25

solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25

Synonyms: MCSC PCSCL RP11-395P17.4 SCAMC-2
Gene ID:
Human(114789) Summary: The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
Mouse(227731) solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Rat(246771) solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
chicken(417230) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
domestic cat(101095448) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Horse(100070341) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
dog(491321) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
cow(527786) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
sheep(101121668) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
domestic guinea pig(100723183) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Domestic Rabbit(100353487) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
naked mole-rat(101712492) solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052901 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006641 Rosetta Predictions human pricing
NM_001006642 Rosetta Predictions human pricing
NM_001006643 Rosetta Predictions human pricing
NM_052901 Rosetta Predictions human pricing
NM_145677 Rosetta Predictions rat pricing
NM_146118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104808 predicted 988
2 SASI_Hs01_00104809 predicted 1278
3 SASI_Hs01_00104810 predicted 1817
4 SASI_Hs01_00104811 predicted 1467
5 SASI_Hs01_00104812 predicted 893
6 SASI_Hs02_00305115 predicted 1276
7 SASI_Hs01_00104814 predicted 952
8 SASI_Hs01_00104815 predicted 1696
9 SASI_Hs01_00104816 predicted 1268
10 SASI_Hs01_00104817 predicted 1570
11 SASI_Hs01_00104813 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129526 predicted 852
2 SASI_Hs01_00129527 predicted 1144
3 SASI_Hs01_00129528 predicted 1678
4 SASI_Hs01_00129529 predicted 1325
5 SASI_Hs01_00129530 predicted 748
6 SASI_Hs02_00305116 predicted 1142
7 SASI_Hs01_00129532 predicted 811
8 SASI_Hs01_00129533 predicted 1556
9 SASI_Hs01_00129534 predicted 1124
10 SASI_Hs01_00129535 predicted 1428
11 SASI_Hs01_00129531 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027766 predicted 820
2 SASI_Hs01_00027767 predicted 1116
3 SASI_Hs01_00027768 predicted 1649
4 SASI_Hs01_00027769 predicted 1301
5 SASI_Hs01_00027770 predicted 719
6 SASI_Hs02_00305117 predicted 1113
7 SASI_Hs01_00027772 predicted 782
8 SASI_Hs01_00027773 predicted 1530
9 SASI_Hs01_00027774 predicted 1101
10 SASI_Hs01_00027775 predicted 1399
11 SASI_Hs01_00027771 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238095 predicted 800
2 SASI_Hs01_00238096 predicted 1093
3 SASI_Hs01_00238097 predicted 1620
4 SASI_Hs01_00238098 predicted 1275
5 SASI_Hs01_00238099 predicted 702
6 SASI_Hs02_00361641 predicted 1090
7 SASI_Hs01_00238101 predicted 759
8 SASI_Hs01_00238102 predicted 1510
9 SASI_Hs01_00238103 predicted 1073
10 SASI_Hs01_00238104 predicted 1371
11 SASI_Hs01_00238100 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268730 predicted 721
2 SASI_Rn02_00268731 predicted 425
3 SASI_Rn01_00117716 predicted 584
4 SASI_Rn01_00117717 predicted 295
5 SASI_Rn01_00117718 predicted 759
6 SASI_Rn01_00117719 predicted 872
7 SASI_Rn01_00117720 predicted 1154
8 SASI_Rn01_00117721 predicted 1156
9 SASI_Rn01_00117722 predicted 1601
10 SASI_Rn01_00117723 predicted 386
11 SASI_Rn01_00117714 predicted 562
12 SASI_Rn01_00117715 predicted 1440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078721 predicted 860
2 SASI_Mm01_00078722 predicted 912
3 SASI_Mm01_00078723 predicted 693
4 SASI_Mm02_00341781 predicted 561
5 SASI_Mm01_00078724 predicted 1388
6 SASI_Mm01_00078725 predicted 530
7 SASI_Mm01_00078726 predicted 677
8 SASI_Mm01_00078727 predicted 1708
9 SASI_Mm01_00078728 predicted 1461
10 SASI_Mm01_00078729 predicted 451
11 SASI_Mm01_00078730 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146118
SLC25A25 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-769s21c1
Sequence:CCGGTCTTCGATGTCGGTGAGAATCCTCGAGGATTCTCACCGACATCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-1108s21c1
Sequence:CCGGAGACGCTGAGGATCCACGAAACTCGAGTTTCGTGGATCCTCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-449s21c1
Sequence:CCGGCTTTGAAGAGTTTGTACATTACTCGAGTAATGTACAAACTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146118.2-2027s1c1
Sequence:CCGGCCCTCATATCTTTCCACTGATCTCGAGATCAGTGGAAAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-1011s1c1
Sequence:CCGGCGGCCATCAAATTCATGGCATCTCGAGATGCCATGAATTTGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-556s1c1
Sequence:CCGGGCAGGCGGAGAAGATTCTTAACTCGAGTTAAGAATCTTCTCCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-604s1c1
Sequence:CCGGCCCTGTCACCTACATGGATAACTCGAGTTATCCATGTAGGTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-1304s1c1
Sequence:CCGGGCTGTCTATGAGACATTGAAACTCGAGTTTCAATGTCTCATAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146118
SLC25A25 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-769s21c1
Sequence:CCGGTCTTCGATGTCGGTGAGAATCCTCGAGGATTCTCACCGACATCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-1108s21c1
Sequence:CCGGAGACGCTGAGGATCCACGAAACTCGAGTTTCGTGGATCCTCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-449s21c1
Sequence:CCGGCTTTGAAGAGTTTGTACATTACTCGAGTAATGTACAAACTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146118.2-2027s1c1
Sequence:CCGGCCCTCATATCTTTCCACTGATCTCGAGATCAGTGGAAAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-1011s1c1
Sequence:CCGGCGGCCATCAAATTCATGGCATCTCGAGATGCCATGAATTTGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-556s1c1
Sequence:CCGGGCAGGCGGAGAAGATTCTTAACTCGAGTTAAGAATCTTCTCCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-604s1c1
Sequence:CCGGCCCTGTCACCTACATGGATAACTCGAGTTATCCATGTAGGTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-1304s1c1
Sequence:CCGGGCTGTCTATGAGACATTGAAACTCGAGTTTCAATGTCTCATAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146118
SLC25A25 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-769s21c1
Sequence:CCGGTCTTCGATGTCGGTGAGAATCCTCGAGGATTCTCACCGACATCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-1108s21c1
Sequence:CCGGAGACGCTGAGGATCCACGAAACTCGAGTTTCGTGGATCCTCAGCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146118.3-449s21c1
Sequence:CCGGCTTTGAAGAGTTTGTACATTACTCGAGTAATGTACAAACTCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146118.2-2027s1c1
Sequence:CCGGCCCTCATATCTTTCCACTGATCTCGAGATCAGTGGAAAGATATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-1011s1c1
Sequence:CCGGCGGCCATCAAATTCATGGCATCTCGAGATGCCATGAATTTGATGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-556s1c1
Sequence:CCGGGCAGGCGGAGAAGATTCTTAACTCGAGTTAAGAATCTTCTCCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-604s1c1
Sequence:CCGGCCCTGTCACCTACATGGATAACTCGAGTTATCCATGTAGGTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146118.2-1304s1c1
Sequence:CCGGGCTGTCTATGAGACATTGAAACTCGAGTTTCAATGTCTCATAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052901
SLC25A25 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052901.2-1905s21c1
Sequence:CCGGCCCTCGTCCAATCCCATAATCCTCGAGGATTATGGGATTGGACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-792s21c1
Sequence:CCGGCCCGAATCAGCCATCAAATTCCTCGAGGAATTTGATGGCTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-352s21c1
Sequence:CCGGGGGACTTGGGAGTCAAGATATCTCGAGATATCTTGACTCCCAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-109s21c1
Sequence:CCGGCTGCCGAGCTGAAGTCCATTTCTCGAGAAATGGACTTCAGCTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-73s21c1
Sequence:CCGGAGACCGAGTTCCAGTACTTTGCTCGAGCAAAGTACTGGAACTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-1057s1c1
Sequence:CCGGGCCGCCTTCTACAAAGGCTATCTCGAGATAGCCTTTGTAGAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-232s1c1
Sequence:CCGGGCTGGAGATAAGGACCTTGATCTCGAGATCAAGGTCCTTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-255s1c1
Sequence:CCGGGCAGCTAGACTTTGAAGAATTCTCGAGAATTCTTCAAAGTCTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-832s1c1
Sequence:CCGGGCCATCAAATTCATGGCCTATCTCGAGATAGGCCATGAATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-1422s1c1
Sequence:CCGGCGTGGTCTACGAGAACCTGAACTCGAGTTCAGGTTCTCGTAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052901
SLC25A25 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052901.2-1905s21c1
Sequence:CCGGCCCTCGTCCAATCCCATAATCCTCGAGGATTATGGGATTGGACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-792s21c1
Sequence:CCGGCCCGAATCAGCCATCAAATTCCTCGAGGAATTTGATGGCTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-352s21c1
Sequence:CCGGGGGACTTGGGAGTCAAGATATCTCGAGATATCTTGACTCCCAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-109s21c1
Sequence:CCGGCTGCCGAGCTGAAGTCCATTTCTCGAGAAATGGACTTCAGCTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-73s21c1
Sequence:CCGGAGACCGAGTTCCAGTACTTTGCTCGAGCAAAGTACTGGAACTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-1057s1c1
Sequence:CCGGGCCGCCTTCTACAAAGGCTATCTCGAGATAGCCTTTGTAGAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-232s1c1
Sequence:CCGGGCTGGAGATAAGGACCTTGATCTCGAGATCAAGGTCCTTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-255s1c1
Sequence:CCGGGCAGCTAGACTTTGAAGAATTCTCGAGAATTCTTCAAAGTCTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-832s1c1
Sequence:CCGGGCCATCAAATTCATGGCCTATCTCGAGATAGGCCATGAATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-1422s1c1
Sequence:CCGGCGTGGTCTACGAGAACCTGAACTCGAGTTCAGGTTCTCGTAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052901
SLC25A25 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052901.2-1905s21c1
Sequence:CCGGCCCTCGTCCAATCCCATAATCCTCGAGGATTATGGGATTGGACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-792s21c1
Sequence:CCGGCCCGAATCAGCCATCAAATTCCTCGAGGAATTTGATGGCTGATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-352s21c1
Sequence:CCGGGGGACTTGGGAGTCAAGATATCTCGAGATATCTTGACTCCCAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-109s21c1
Sequence:CCGGCTGCCGAGCTGAAGTCCATTTCTCGAGAAATGGACTTCAGCTCGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052901.2-73s21c1
Sequence:CCGGAGACCGAGTTCCAGTACTTTGCTCGAGCAAAGTACTGGAACTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-1057s1c1
Sequence:CCGGGCCGCCTTCTACAAAGGCTATCTCGAGATAGCCTTTGTAGAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-232s1c1
Sequence:CCGGGCTGGAGATAAGGACCTTGATCTCGAGATCAAGGTCCTTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-255s1c1
Sequence:CCGGGCAGCTAGACTTTGAAGAATTCTCGAGAATTCTTCAAAGTCTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-832s1c1
Sequence:CCGGGCCATCAAATTCATGGCCTATCTCGAGATAGGCCATGAATTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052901.1-1422s1c1
Sequence:CCGGCGTGGTCTACGAGAACCTGAACTCGAGTTCAGGTTCTCGTAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks