EMAIL THIS PAGE TO A FRIEND

SLC25A44

solute carrier family 25, member 44

Synonyms: RP11-54H19.3
UniProtKB ID: Q96H78, O75034
Gene ID:
Human(9673) Summary: SLC25A44 belongs to the SLC25 family of mitochondrial carrier proteins (Haitina et al., 2006 [PubMed 16949250]
Mouse(229517) solute carrier family 25, member 44
Rat(365841) solute carrier family 25, member 44
domestic guinea pig(100721549) solute carrier family 25, member 44
naked mole-rat(101707594) solute carrier family 25, member 44
cow(505860) solute carrier family 25, member 44
sheep(101102024) solute carrier family 25, member 44
dog(490415) solute carrier family 25, member 44
domestic cat(101083902) solute carrier family 25, member 44
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106657 Anti-SLC25A44 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human
ELISA, western blot pricing
HPA065411 Anti-SLC25A44 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014655 Rosetta Predictions human pricing
NM_001108947 Rosetta Predictions rat pricing
NM_178696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121667 predicted 711
2 SASI_Hs01_00121668 predicted 442
3 SASI_Hs01_00121670 predicted 428
4 SASI_Hs01_00121671 predicted 1031
5 SASI_Hs01_00121673 predicted 706
6 SASI_Hs01_00121675 predicted 535
7 SASI_Hs02_00345991 predicted 909
8 SASI_Hs01_00121676 predicted 415
9 SASI_Hs02_00345992 predicted 408
10 SASI_Hs02_00345993 predicted 250
11 SASI_Hs01_00121669 predicted 470
12 SASI_Hs01_00121672 predicted 633
13 SASI_Hs01_00121674 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243654 predicted 1364
2 SASI_Rn02_00243655 predicted 504
3 SASI_Rn02_00243656 predicted 704
4 SASI_Rn02_00243657 predicted 1115
5 SASI_Rn02_00243658 predicted 725
6 SASI_Rn02_00243659 predicted 1285
7 SASI_Rn02_00243660 predicted 416
8 SASI_Rn02_00243661 predicted 689
9 SASI_Rn02_00243662 predicted 462
10 SASI_Rn02_00243663 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156121 predicted 893
2 SASI_Mm01_00156122 predicted 1239
3 SASI_Mm01_00156123 predicted 876
4 SASI_Mm01_00156124 predicted 714
5 SASI_Mm01_00156125 predicted 917
6 SASI_Mm01_00156126 predicted 459
7 SASI_Mm01_00156127 predicted 712
8 SASI_Mm01_00156128 predicted 699
9 SASI_Mm01_00156129 predicted 672
10 SASI_Mm01_00156130 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014655
VALIDATED
SLC25A44 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 44
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014655.2-585s21c1
Sequence:CCGGAGTGTTATGTCACCACTTATGCTCGAGCATAAGTGGTGACATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-2938s21c1
Sequence:CCGGCCAGGAATGTTCACATCCAAACTCGAGTTTGGATGTGAACATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-636s21c1
Sequence:CCGGGCCAGAGTAACACAGTCAAATCTCGAGATTTGACTGTGTTACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-883s21c1
Sequence:CCGGGGCTTCACTGCTTACCTATATCTCGAGATATAGGTAAGCAGTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-543s21c1
Sequence:CCGGACCGAGGGTTCCTGGTCAATACTCGAGTATTGACCAGGAACCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014655.1-1020s1c1
Sequence:CCGGCATTGTCATTGTGGTGGGCTACTCGAGTAGCCCACCACAATGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-465s1c1
Sequence:CCGGCAGCCAGAGTAACACAGTCAACTCGAGTTGACTGTGTTACTCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-467s1c1
Sequence:CCGGGCCAGAGTAACACAGTCAAATCTCGAGATTTGACTGTGTTACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-2771s1c1
Sequence:CCGGCCAGGAATGTTCACATCCAAACTCGAGTTTGGATGTGAACATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-201s1c1
Sequence:CCGGCAAGAAGAAGTTCTACGTGTTCTCGAGAACACGTAGAACTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014655
VALIDATED
SLC25A44 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 44
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014655.2-585s21c1
Sequence:CCGGAGTGTTATGTCACCACTTATGCTCGAGCATAAGTGGTGACATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-2938s21c1
Sequence:CCGGCCAGGAATGTTCACATCCAAACTCGAGTTTGGATGTGAACATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-636s21c1
Sequence:CCGGGCCAGAGTAACACAGTCAAATCTCGAGATTTGACTGTGTTACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-883s21c1
Sequence:CCGGGGCTTCACTGCTTACCTATATCTCGAGATATAGGTAAGCAGTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-543s21c1
Sequence:CCGGACCGAGGGTTCCTGGTCAATACTCGAGTATTGACCAGGAACCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014655.1-1020s1c1
Sequence:CCGGCATTGTCATTGTGGTGGGCTACTCGAGTAGCCCACCACAATGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-465s1c1
Sequence:CCGGCAGCCAGAGTAACACAGTCAACTCGAGTTGACTGTGTTACTCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-467s1c1
Sequence:CCGGGCCAGAGTAACACAGTCAAATCTCGAGATTTGACTGTGTTACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-2771s1c1
Sequence:CCGGCCAGGAATGTTCACATCCAAACTCGAGTTTGGATGTGAACATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-201s1c1
Sequence:CCGGCAAGAAGAAGTTCTACGTGTTCTCGAGAACACGTAGAACTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014655
VALIDATED
SLC25A44 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 44
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014655.2-585s21c1
Sequence:CCGGAGTGTTATGTCACCACTTATGCTCGAGCATAAGTGGTGACATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-2938s21c1
Sequence:CCGGCCAGGAATGTTCACATCCAAACTCGAGTTTGGATGTGAACATTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-636s21c1
Sequence:CCGGGCCAGAGTAACACAGTCAAATCTCGAGATTTGACTGTGTTACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-883s21c1
Sequence:CCGGGGCTTCACTGCTTACCTATATCTCGAGATATAGGTAAGCAGTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_014655.2-543s21c1
Sequence:CCGGACCGAGGGTTCCTGGTCAATACTCGAGTATTGACCAGGAACCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014655.1-1020s1c1
Sequence:CCGGCATTGTCATTGTGGTGGGCTACTCGAGTAGCCCACCACAATGACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-465s1c1
Sequence:CCGGCAGCCAGAGTAACACAGTCAACTCGAGTTGACTGTGTTACTCTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-467s1c1
Sequence:CCGGGCCAGAGTAACACAGTCAAATCTCGAGATTTGACTGTGTTACTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-2771s1c1
Sequence:CCGGCCAGGAATGTTCACATCCAAACTCGAGTTTGGATGTGAACATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014655.1-201s1c1
Sequence:CCGGCAAGAAGAAGTTCTACGTGTTCTCGAGAACACGTAGAACTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178696
VALIDATED
SLC25A44 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 25, member 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178696.2-453s1c1
Sequence:CCGGCAAGAAGAAGTTCTATGTGTTCTCGAGAACACATAGAACTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-1009s1c1
Sequence:CCGGCCCTTCTACCACTTCTATGCACTCGAGTGCATAGAAGTGGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-665s1c1
Sequence:CCGGGCCAGTGCTATGTCACCACTTCTCGAGAAGTGGTGACATAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-972s1c1
Sequence:CCGGGCTGCTAACGTACATCCCAAACTCGAGTTTGGGATGTACGTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-3042s1c1
Sequence:CCGGGCTTTCACTATCAAGACCTTTCTCGAGAAAGGTCTTGATAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178696
VALIDATED
SLC25A44 MISSION shRNA shRNA Plasmid DNA
solute carrier family 25, member 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178696.2-453s1c1
Sequence:CCGGCAAGAAGAAGTTCTATGTGTTCTCGAGAACACATAGAACTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-1009s1c1
Sequence:CCGGCCCTTCTACCACTTCTATGCACTCGAGTGCATAGAAGTGGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-665s1c1
Sequence:CCGGGCCAGTGCTATGTCACCACTTCTCGAGAAGTGGTGACATAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-972s1c1
Sequence:CCGGGCTGCTAACGTACATCCCAAACTCGAGTTTGGGATGTACGTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-3042s1c1
Sequence:CCGGGCTTTCACTATCAAGACCTTTCTCGAGAAAGGTCTTGATAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178696
VALIDATED
SLC25A44 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 25, member 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178696.2-453s1c1
Sequence:CCGGCAAGAAGAAGTTCTATGTGTTCTCGAGAACACATAGAACTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-1009s1c1
Sequence:CCGGCCCTTCTACCACTTCTATGCACTCGAGTGCATAGAAGTGGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-665s1c1
Sequence:CCGGGCCAGTGCTATGTCACCACTTCTCGAGAAGTGGTGACATAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-972s1c1
Sequence:CCGGGCTGCTAACGTACATCCCAAACTCGAGTTTGGGATGTACGTTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178696.2-3042s1c1
Sequence:CCGGGCTTTCACTATCAAGACCTTTCTCGAGAAAGGTCTTGATAGTGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks