EMAIL THIS PAGE TO A FRIEND

SLC26A4

solute carrier family 26 (anion exchanger), member 4

Synonyms: DFNB4 EVA PDS TDH2B
UniProtKB ID: O43511, O43170
Gene ID:
Human(5172) Summary: Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
Mouse(23985) solute carrier family 26, member 4
Rat(29440) solute carrier family 26 (anion exchanger), member 4
domestic guinea pig(100718397) solute carrier family 26, member 4
Domestic Rabbit(100345415) solute carrier family 26, member 4
naked mole-rat(101702473) solute carrier family 26, member 4
cow(530241) solute carrier family 26, member 4
sheep(101104654) solute carrier family 26, member 4
Zebrafish(563818) solute carrier family 26, member 4
Horse(100060222) solute carrier family 26, member 4
domestic cat(101095090) solute carrier family 26, member 4
dog(483263) solute carrier family 26, member 4
chicken(427845) solute carrier family 26, member 4
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000441 Rosetta Predictions human pricing
NM_019214 Rosetta Predictions rat pricing
NM_011867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012984 predicted 1491
2 SASI_Hs02_00302558 predicted 2388
3 SASI_Hs01_00012986 predicted 2124
4 SASI_Hs01_00012987 predicted 2464
5 SASI_Hs01_00012988 predicted 1124
6 SASI_Hs01_00012989 predicted 924
7 SASI_Hs01_00012990 predicted 539
8 SASI_Hs01_00012991 predicted 1336
9 SASI_Hs02_00302559 predicted 1138
10 SASI_Hs02_00302560 predicted 2026
11 SASI_Hs01_00012985 predicted 423
12 SASI_Hs01_00012992 predicted 747
13 SASI_Hs01_00012993 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262056 predicted 515
2 SASI_Rn01_00106597 predicted 1735
3 SASI_Rn02_00262057 predicted 2046
4 SASI_Rn01_00106601 predicted 1937
5 SASI_Rn01_00106602 predicted 1811
6 SASI_Rn01_00106603 predicted 1451
7 SASI_Rn01_00106604 predicted 1765
8 SASI_Rn01_00106605 predicted 2099
9 SASI_Rn01_00106606 predicted 632
10 SASI_Rn02_00262058 predicted 934
11 SASI_Rn01_00106598 predicted 969
12 SASI_Rn01_00106599 predicted 274
13 SASI_Rn01_00106600 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107229 predicted 2458
2 SASI_Mm02_00321643 predicted 2243
3 SASI_Mm01_00107230 predicted 249
4 SASI_Mm01_00107231 predicted 1064
5 SASI_Mm01_00107232 predicted 1171
6 SASI_Mm01_00107233 predicted 2649
7 SASI_Mm01_00107235 predicted 2647
8 SASI_Mm02_00321644 predicted 2280
9 SASI_Mm01_00107237 predicted 722
10 SASI_Mm02_00321645 predicted 1120
11 SASI_Mm01_00107228 predicted 1665
12 SASI_Mm01_00107234 predicted 2153
13 SASI_Mm01_00107236 predicted 832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011867
SLC26A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011867.3-2233s21c1
Sequence:CCGGTGAGGTCATTGCGAATGATTGCTCGAGCAATCATTCGCAATGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-2011s1c1
Sequence:CCGGGCAACCAAGAACGGGATCATACTCGAGTATGATCCCGTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-711s1c1
Sequence:CCGGCGGTAACGGAAGTGCATTGAACTCGAGTTCAATGCACTTCCGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-931s1c1
Sequence:CCGGGTGCTCAATGTTTCAACCAAACTCGAGTTTGGTTGAAACATTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-2104s1c1
Sequence:CCGGCCAACCAAAGAAATTGAGATTCTCGAGAATCTCAATTTCTTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-1066s1c1
Sequence:CCGGGCTGTTAAGGAACTAAATGATCTCGAGATCATTTAGTTCCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011867
SLC26A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011867.3-2233s21c1
Sequence:CCGGTGAGGTCATTGCGAATGATTGCTCGAGCAATCATTCGCAATGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-2011s1c1
Sequence:CCGGGCAACCAAGAACGGGATCATACTCGAGTATGATCCCGTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-711s1c1
Sequence:CCGGCGGTAACGGAAGTGCATTGAACTCGAGTTCAATGCACTTCCGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-931s1c1
Sequence:CCGGGTGCTCAATGTTTCAACCAAACTCGAGTTTGGTTGAAACATTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-2104s1c1
Sequence:CCGGCCAACCAAAGAAATTGAGATTCTCGAGAATCTCAATTTCTTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-1066s1c1
Sequence:CCGGGCTGTTAAGGAACTAAATGATCTCGAGATCATTTAGTTCCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011867
SLC26A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011867.3-2233s21c1
Sequence:CCGGTGAGGTCATTGCGAATGATTGCTCGAGCAATCATTCGCAATGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-2011s1c1
Sequence:CCGGGCAACCAAGAACGGGATCATACTCGAGTATGATCCCGTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-711s1c1
Sequence:CCGGCGGTAACGGAAGTGCATTGAACTCGAGTTCAATGCACTTCCGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-931s1c1
Sequence:CCGGGTGCTCAATGTTTCAACCAAACTCGAGTTTGGTTGAAACATTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-2104s1c1
Sequence:CCGGCCAACCAAAGAAATTGAGATTCTCGAGAATCTCAATTTCTTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011867.1-1066s1c1
Sequence:CCGGGCTGTTAAGGAACTAAATGATCTCGAGATCATTTAGTTCCTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000441
SLC26A4 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-2068s21c1
Sequence:CCGGTTGAGCCTGATGAGGATATTGCTCGAGCAATATCCTCATCAGGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-1131s21c1
Sequence:CCGGGAAGTAATTGTGACGATAATTCTCGAGAATTATCGTCACAATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-1334s21c1
Sequence:CCGCATATGCCACCAAGTATGATTACTCGAGTAATCATACTTGGTGGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000441.1-2906s21c1
Sequence:CCGGCAAGCGAGTCACGAATGATTACTCGAGTAATCATTCGTGACTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-1509s1c1
Sequence:CCGGGCGATTGTGATGATCGCCATTCTCGAGAATGGCGATCATCACAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-715s1c1
Sequence:CCGGCCAGCAGCAATGGAACTGTATCTCGAGATACAGTTCCATTGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-2214s1c1
Sequence:CCGGGCTATATCTTTCCTGGACGTTCTCGAGAACGTCCAGGAAAGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-590s1c1
Sequence:CCGGCCCTATCCTGACATACTTTATCTCGAGATAAAGTATGTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-1591s1c1
Sequence:CCGGCCAACCTGAAAGGGATGTTTACTCGAGTAAACATCCCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000441
SLC26A4 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-2068s21c1
Sequence:CCGGTTGAGCCTGATGAGGATATTGCTCGAGCAATATCCTCATCAGGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-1131s21c1
Sequence:CCGGGAAGTAATTGTGACGATAATTCTCGAGAATTATCGTCACAATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-1334s21c1
Sequence:CCGCATATGCCACCAAGTATGATTACTCGAGTAATCATACTTGGTGGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000441.1-2906s21c1
Sequence:CCGGCAAGCGAGTCACGAATGATTACTCGAGTAATCATTCGTGACTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-1509s1c1
Sequence:CCGGGCGATTGTGATGATCGCCATTCTCGAGAATGGCGATCATCACAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-715s1c1
Sequence:CCGGCCAGCAGCAATGGAACTGTATCTCGAGATACAGTTCCATTGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-2214s1c1
Sequence:CCGGGCTATATCTTTCCTGGACGTTCTCGAGAACGTCCAGGAAAGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-590s1c1
Sequence:CCGGCCCTATCCTGACATACTTTATCTCGAGATAAAGTATGTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-1591s1c1
Sequence:CCGGCCAACCTGAAAGGGATGTTTACTCGAGTAAACATCCCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000441
SLC26A4 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-2068s21c1
Sequence:CCGGTTGAGCCTGATGAGGATATTGCTCGAGCAATATCCTCATCAGGCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-1131s21c1
Sequence:CCGGGAAGTAATTGTGACGATAATTCTCGAGAATTATCGTCACAATTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000441.1-1334s21c1
Sequence:CCGCATATGCCACCAAGTATGATTACTCGAGTAATCATACTTGGTGGCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000441.1-2906s21c1
Sequence:CCGGCAAGCGAGTCACGAATGATTACTCGAGTAATCATTCGTGACTCGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-1509s1c1
Sequence:CCGGGCGATTGTGATGATCGCCATTCTCGAGAATGGCGATCATCACAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-715s1c1
Sequence:CCGGCCAGCAGCAATGGAACTGTATCTCGAGATACAGTTCCATTGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-2214s1c1
Sequence:CCGGGCTATATCTTTCCTGGACGTTCTCGAGAACGTCCAGGAAAGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-590s1c1
Sequence:CCGGCCCTATCCTGACATACTTTATCTCGAGATAAAGTATGTCAGGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000441.1-1591s1c1
Sequence:CCGGCCAACCTGAAAGGGATGTTTACTCGAGTAAACATCCCTTTCAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks