EMAIL THIS PAGE TO A FRIEND

SLC26A9

solute carrier family 26 (anion exchanger), member 9

UniProtKB ID: Q7LBE3, A7E2V6, B1AVM9, B7ZKK2, Q96PK9, Q96RN0
Gene ID:
Human(115019) Summary: This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
Mouse(320718) solute carrier family 26, member 9
Rat(304784) solute carrier family 26 (anion exchanger), member 9
chicken(428262) solute carrier family 26, member 9
domestic cat(101087807) solute carrier family 26, member 9
Horse(100050693) solute carrier family 26, member 9
dog(478948) solute carrier family 26, member 9
cow(508958) solute carrier family 26 (anion exchanger), member 9
sheep(101111646) solute carrier family 26, member 9
naked mole-rat(101701213) solute carrier family 26, member 9
Domestic Rabbit(100346998) solute carrier family 26, member 9
domestic guinea pig(100717762) solute carrier family 26, member 9
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126191 MISSION® esiRNA esiRNA human SLC26A9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052934 Rosetta Predictions human pricing
NM_134325 Rosetta Predictions human pricing
NM_001107172 Rosetta Predictions rat pricing
NM_177243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227510 predicted 1836
2 SASI_Hs01_00227511 predicted 1107
3 SASI_Hs01_00227512 predicted 546
4 SASI_Hs01_00227514 predicted 392
5 SASI_Hs02_00361714 predicted 1669
6 SASI_Hs01_00227515 predicted 1601
7 SASI_Hs01_00227516 predicted 2255
8 SASI_Hs01_00227517 predicted 570
9 SASI_Hs01_00227518 predicted 1835
10 SASI_Hs02_00361715 predicted 1214
11 SASI_Hs01_00227509 predicted 1242
12 SASI_Hs01_00227513 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046278 predicted 2771
2 SASI_Hs01_00046279 predicted 1836
3 SASI_Hs01_00046280 predicted 1101
4 SASI_Hs01_00046281 predicted 2772
5 SASI_Hs01_00046282 predicted 542
6 SASI_Hs01_00046284 predicted 396
7 SASI_Hs02_00363311 predicted 1662
8 SASI_Hs01_00046285 predicted 1606
9 SASI_Hs01_00046286 predicted 2252
10 SASI_Hs01_00046287 predicted 570
11 SASI_Hs01_00046283 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226215 predicted 1687
2 SASI_Rn02_00226216 predicted 2255
3 SASI_Rn02_00226217 predicted 435
4 SASI_Rn02_00226218 predicted 1667
5 SASI_Rn02_00226219 predicted 2163
6 SASI_Rn02_00226220 predicted 1681
7 SASI_Rn02_00226221 predicted 679
8 SASI_Rn02_00226222 predicted 1375
9 SASI_Rn02_00226223 predicted 325
10 SASI_Rn02_00226224 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193140 predicted 2375
2 SASI_Mm01_00193141 predicted 1683
3 SASI_Mm01_00193144 predicted 2412
4 SASI_Mm01_00193145 predicted 2251
5 SASI_Mm01_00193146 predicted 1122
6 SASI_Mm01_00193147 predicted 1595
7 SASI_Mm01_00193148 predicted 319
8 SASI_Mm02_00347281 predicted 2485
9 SASI_Mm01_00193149 predicted 2157
10 SASI_Mm02_00347282 predicted 2134
11 SASI_Mm01_00193142 predicted 543
12 SASI_Mm01_00193143 predicted 2493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052934
VALIDATED
SLC26A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-934s1c1
Sequence:CCGGGCTCGCTACATGCACAAGATTCTCGAGAATCTTGTGCATGTAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-211s1c1
Sequence:CCGGGTGGGAGAGAAACTTCGCAATCTCGAGATTGCGAAGTTTCTCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052934.2-756s1c1
Sequence:CCGGGATCCTGATTTCGGTGCTCAACTCGAGTTGAGCACCGAAATCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-2225s1c1
Sequence:CCGGCCCAGGTGTACAATGACATTACTCGAGTAATGTCATTGTACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-1788s1c1
Sequence:CCGGCCAGAAAGTATTACTAGCCAACTCGAGTTGGCTAGTAATACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-1657s21c1
Sequence:CCGGGTGAATCCCAAGACCTATAATCTCGAGATTATAGGTCTTGGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052934.3-2943s21c1
Sequence:CCGGGTCACGGACATAGGGATAAACCTCGAGGTTTATCCCTATGTCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-756s21c1
Sequence:CCGGGATCCTGATTTCGGTGCTCAACTCGAGTTGAGCACCGAAATCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-827s21c1
Sequence:CCGGTCTTTACCTTCATTGACATTTCTCGAGAAATGTCAATGAAGGTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-2276s21c1
Sequence:CCGGTAGAATGCAAGCACGTCTTTCCTCGAGGAAAGACGTGCTTGCATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052934
VALIDATED
SLC26A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-934s1c1
Sequence:CCGGGCTCGCTACATGCACAAGATTCTCGAGAATCTTGTGCATGTAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-211s1c1
Sequence:CCGGGTGGGAGAGAAACTTCGCAATCTCGAGATTGCGAAGTTTCTCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052934.2-756s1c1
Sequence:CCGGGATCCTGATTTCGGTGCTCAACTCGAGTTGAGCACCGAAATCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-2225s1c1
Sequence:CCGGCCCAGGTGTACAATGACATTACTCGAGTAATGTCATTGTACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-1788s1c1
Sequence:CCGGCCAGAAAGTATTACTAGCCAACTCGAGTTGGCTAGTAATACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-1657s21c1
Sequence:CCGGGTGAATCCCAAGACCTATAATCTCGAGATTATAGGTCTTGGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052934.3-2943s21c1
Sequence:CCGGGTCACGGACATAGGGATAAACCTCGAGGTTTATCCCTATGTCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-756s21c1
Sequence:CCGGGATCCTGATTTCGGTGCTCAACTCGAGTTGAGCACCGAAATCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-827s21c1
Sequence:CCGGTCTTTACCTTCATTGACATTTCTCGAGAAATGTCAATGAAGGTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-2276s21c1
Sequence:CCGGTAGAATGCAAGCACGTCTTTCCTCGAGGAAAGACGTGCTTGCATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052934
VALIDATED
SLC26A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-934s1c1
Sequence:CCGGGCTCGCTACATGCACAAGATTCTCGAGAATCTTGTGCATGTAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-211s1c1
Sequence:CCGGGTGGGAGAGAAACTTCGCAATCTCGAGATTGCGAAGTTTCTCTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_052934.2-756s1c1
Sequence:CCGGGATCCTGATTTCGGTGCTCAACTCGAGTTGAGCACCGAAATCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-2225s1c1
Sequence:CCGGCCCAGGTGTACAATGACATTACTCGAGTAATGTCATTGTACACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052934.2-1788s1c1
Sequence:CCGGCCAGAAAGTATTACTAGCCAACTCGAGTTGGCTAGTAATACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-1657s21c1
Sequence:CCGGGTGAATCCCAAGACCTATAATCTCGAGATTATAGGTCTTGGGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052934.3-2943s21c1
Sequence:CCGGGTCACGGACATAGGGATAAACCTCGAGGTTTATCCCTATGTCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-756s21c1
Sequence:CCGGGATCCTGATTTCGGTGCTCAACTCGAGTTGAGCACCGAAATCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-827s21c1
Sequence:CCGGTCTTTACCTTCATTGACATTTCTCGAGAAATGTCAATGAAGGTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052934.3-2276s21c1
Sequence:CCGGTAGAATGCAAGCACGTCTTTCCTCGAGGAAAGACGTGCTTGCATTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177243
SLC26A9 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 26 (anion exchanger), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-787s1c1
Sequence:CCGGCTGACCATTCCCTCCTATACACTCGAGTGTATAGGAGGGAATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-1190s1c1
Sequence:CCGGGCTATGATGTGGATTCTAACCCTCGAGGGTTAGAATCCACATCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-2119s1c1
Sequence:CCGGAGTGGAGTCAGCTTTGTGGATCTCGAGATCCACAAAGCTGACTCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-1681s1c1
Sequence:CCGGCAGGAAATTGCGGGAGTTAAGCTCGAGCTTAACTCCCGCAATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-927s1c1
Sequence:CCGGCAACGCTCGGTACATGCACAACTCGAGTTGTGCATGTACCGAGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177243
SLC26A9 MISSION shRNA shRNA Plasmid DNA
solute carrier family 26 (anion exchanger), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-787s1c1
Sequence:CCGGCTGACCATTCCCTCCTATACACTCGAGTGTATAGGAGGGAATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-1190s1c1
Sequence:CCGGGCTATGATGTGGATTCTAACCCTCGAGGGTTAGAATCCACATCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-2119s1c1
Sequence:CCGGAGTGGAGTCAGCTTTGTGGATCTCGAGATCCACAAAGCTGACTCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-1681s1c1
Sequence:CCGGCAGGAAATTGCGGGAGTTAAGCTCGAGCTTAACTCCCGCAATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-927s1c1
Sequence:CCGGCAACGCTCGGTACATGCACAACTCGAGTTGTGCATGTACCGAGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177243
SLC26A9 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 26 (anion exchanger), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-787s1c1
Sequence:CCGGCTGACCATTCCCTCCTATACACTCGAGTGTATAGGAGGGAATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-1190s1c1
Sequence:CCGGGCTATGATGTGGATTCTAACCCTCGAGGGTTAGAATCCACATCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-2119s1c1
Sequence:CCGGAGTGGAGTCAGCTTTGTGGATCTCGAGATCCACAAAGCTGACTCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-1681s1c1
Sequence:CCGGCAGGAAATTGCGGGAGTTAAGCTCGAGCTTAACTCCCGCAATTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177243.x-927s1c1
Sequence:CCGGCAACGCTCGGTACATGCACAACTCGAGTTGTGCATGTACCGAGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks