EMAIL THIS PAGE TO A FRIEND

SLC27A3

solute carrier family 27 (fatty acid transporter), member 3

Synonyms: ACSVL3 FATP3 VLCS-3
Gene ID:
Mouse(26568) solute carrier family 27 (fatty acid transporter), member 3
Rat(295219) solute carrier family 27 (fatty acid transporter), member 3
domestic cat(101087198) solute carrier family 27 (fatty acid transporter), member 3
dog(612311) solute carrier family 27 (fatty acid transporter), member 3
domestic guinea pig(100726583) solute carrier family 27 (fatty acid transporter), member 3
Domestic Rabbit(100340848) solute carrier family 27 (fatty acid transporter), member 3
naked mole-rat(101711552) solute carrier family 27 (fatty acid transporter), member 3
cow(511053) solute carrier family 27 (fatty acid transporter), member 3
sheep(101101860) solute carrier family 27 (fatty acid transporter), member 3
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_130954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043651 MISSION® esiRNA esiRNA human SLC27A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024330 Rosetta Predictions human pricing
NM_001106439 Rosetta Predictions rat pricing
NM_011988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100092 predicted 2030
2 SASI_Hs01_00100093 predicted 1492
3 SASI_Hs02_00356683 predicted 2110
4 SASI_Hs01_00100094 predicted 1413
5 SASI_Hs01_00100095 predicted 991
6 SASI_Hs01_00100096 predicted 1886
7 SASI_Hs01_00100097 predicted 2152
8 SASI_Hs02_00356684 predicted 2113
9 SASI_Hs01_00100098 predicted 1413
10 SASI_Hs01_00100099 predicted 2001
11 SASI_Hs01_00100100 predicted 1890
12 SASI_Hs01_00100101 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218968 predicted 2020
2 SASI_Rn02_00218969 predicted 1394
3 SASI_Rn02_00218970 predicted 1753
4 SASI_Rn02_00218971 predicted 839
5 SASI_Rn02_00218972 predicted 1929
6 SASI_Rn02_00218973 predicted 1227
7 SASI_Rn02_00218974 predicted 1984
8 SASI_Rn02_00218975 predicted 1019
9 SASI_Rn02_00218976 predicted 1909
10 SASI_Rn02_00218977 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093273 predicted 1377
2 SASI_Mm01_00093274 predicted 1916
3 SASI_Mm01_00093275 predicted 1375
4 SASI_Mm01_00093276 predicted 1427
5 SASI_Mm01_00093277 predicted 1051
6 SASI_Mm01_00093278 predicted 670
7 SASI_Mm01_00093279 predicted 1954
8 SASI_Mm01_00093280 predicted 622
9 SASI_Mm01_00093281 predicted 1452
10 SASI_Mm01_00093282 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024330
SLC27A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 27 (fatty acid transporter), member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024330.1-1892s21c1
Sequence:CCGGGGTCTTCGAGGCCCTAGATTTCTCGAGAAATCTAGGGCCTCGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024330.1-1123s21c1
Sequence:CCGGTGCAATGCCAGGGCTTCTATCCTCGAGGATAGAAGCCCTGGCATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-956s1c1
Sequence:CCGGCCCTGCTGGAATTAGCGATTTCTCGAGAAATCGCTAATTCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-1572s1c1
Sequence:CCGGCCCTTCTCCTTGATTCGCTATCTCGAGATAGCGAATCAAGGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-1550s1c1
Sequence:CCGGCTGGCTTTACAAGCATATCTTCTCGAGAAGATATGCTTGTAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-2100s1c1
Sequence:CCGGGAGACCTTCAAACAGCAGAAACTCGAGTTTCTGCTGTTTGAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-2114s1c1
Sequence:CCGGGCAGAAAGTTCGGATGGCAAACTCGAGTTTGCCATCCGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024330
SLC27A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 27 (fatty acid transporter), member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024330.1-1892s21c1
Sequence:CCGGGGTCTTCGAGGCCCTAGATTTCTCGAGAAATCTAGGGCCTCGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024330.1-1123s21c1
Sequence:CCGGTGCAATGCCAGGGCTTCTATCCTCGAGGATAGAAGCCCTGGCATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-956s1c1
Sequence:CCGGCCCTGCTGGAATTAGCGATTTCTCGAGAAATCGCTAATTCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-1572s1c1
Sequence:CCGGCCCTTCTCCTTGATTCGCTATCTCGAGATAGCGAATCAAGGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-1550s1c1
Sequence:CCGGCTGGCTTTACAAGCATATCTTCTCGAGAAGATATGCTTGTAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-2100s1c1
Sequence:CCGGGAGACCTTCAAACAGCAGAAACTCGAGTTTCTGCTGTTTGAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-2114s1c1
Sequence:CCGGGCAGAAAGTTCGGATGGCAAACTCGAGTTTGCCATCCGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024330
SLC27A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 27 (fatty acid transporter), member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024330.1-1892s21c1
Sequence:CCGGGGTCTTCGAGGCCCTAGATTTCTCGAGAAATCTAGGGCCTCGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024330.1-1123s21c1
Sequence:CCGGTGCAATGCCAGGGCTTCTATCCTCGAGGATAGAAGCCCTGGCATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-956s1c1
Sequence:CCGGCCCTGCTGGAATTAGCGATTTCTCGAGAAATCGCTAATTCCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-1572s1c1
Sequence:CCGGCCCTTCTCCTTGATTCGCTATCTCGAGATAGCGAATCAAGGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-1550s1c1
Sequence:CCGGCTGGCTTTACAAGCATATCTTCTCGAGAAGATATGCTTGTAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-2100s1c1
Sequence:CCGGGAGACCTTCAAACAGCAGAAACTCGAGTTTCTGCTGTTTGAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024330.1-2114s1c1
Sequence:CCGGGCAGAAAGTTCGGATGGCAAACTCGAGTTTGCCATCCGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011988
SLC27A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 27 (fatty acid transporter), member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-2054s21c1
Sequence:CCGGCTATGTTCTGGACCAAGATATCTCGAGATATCTTGGTCCAGAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1378s21c1
Sequence:CCGGGCAACGTAGCTACGTTCAATTCTCGAGAATTGAACGTAGCTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-839s21c1
Sequence:CCGGTGTAGCTGGAATCAGCAATTTCTCGAGAAATTGCTGATTCCAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-2055s21c1
Sequence:CCGGTATGTTCTGGACCAAGATATACTCGAGTATATCTTGGTCCAGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1253s21c1
Sequence:CCGGCAAGGCAGGGTGTGACCATAACTCGAGTTATGGTCACACCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1798s21c1
Sequence:CCGGTTCAGGAGGTGAACATCTATGCTCGAGCATAGATGTTCACCTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-1253s21c1
Sequence:CCGGCAAGGCAGAGTGTGACCATAACTCGAGTTATGGTCACACTCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011988
SLC27A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 27 (fatty acid transporter), member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-2054s21c1
Sequence:CCGGCTATGTTCTGGACCAAGATATCTCGAGATATCTTGGTCCAGAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1378s21c1
Sequence:CCGGGCAACGTAGCTACGTTCAATTCTCGAGAATTGAACGTAGCTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-839s21c1
Sequence:CCGGTGTAGCTGGAATCAGCAATTTCTCGAGAAATTGCTGATTCCAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-2055s21c1
Sequence:CCGGTATGTTCTGGACCAAGATATACTCGAGTATATCTTGGTCCAGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1253s21c1
Sequence:CCGGCAAGGCAGGGTGTGACCATAACTCGAGTTATGGTCACACCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1798s21c1
Sequence:CCGGTTCAGGAGGTGAACATCTATGCTCGAGCATAGATGTTCACCTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-1253s21c1
Sequence:CCGGCAAGGCAGAGTGTGACCATAACTCGAGTTATGGTCACACTCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011988
SLC27A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 27 (fatty acid transporter), member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-2054s21c1
Sequence:CCGGCTATGTTCTGGACCAAGATATCTCGAGATATCTTGGTCCAGAACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1378s21c1
Sequence:CCGGGCAACGTAGCTACGTTCAATTCTCGAGAATTGAACGTAGCTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-839s21c1
Sequence:CCGGTGTAGCTGGAATCAGCAATTTCTCGAGAAATTGCTGATTCCAGCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-2055s21c1
Sequence:CCGGTATGTTCTGGACCAAGATATACTCGAGTATATCTTGGTCCAGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1253s21c1
Sequence:CCGGCAAGGCAGGGTGTGACCATAACTCGAGTTATGGTCACACCCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.1-1798s21c1
Sequence:CCGGTTCAGGAGGTGAACATCTATGCTCGAGCATAGATGTTCACCTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011988.2-1253s21c1
Sequence:CCGGCAAGGCAGAGTGTGACCATAACTCGAGTTATGGTCACACTCTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130954
VALIDATED
SLC27A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 27 (fatty acid transporter), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-650s1c1
Sequence:CCGGGCCCGGATTTCCTTTGGATTTCTCGAGAAATCCAAAGGAAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-2080s1c1
Sequence:CCGGCCACTCTATGTTCTGGACCAACTCGAGTTGGTCCAGAACATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130954.3-1948s1c1
Sequence:CCGGTCTGAGAACTTGCCACCGTATCTCGAGATACGGTGGCAAGTTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-947s1c1
Sequence:CCGGCCCAGAACATAATGGACACCTCTCGAGAGGTGTCCATTATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130954.3-1409s1c1
Sequence:CCGGGCAACGTAGCTACGTTCAATTCTCGAGAATTGAACGTAGCTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130954
VALIDATED
SLC27A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 27 (fatty acid transporter), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-650s1c1
Sequence:CCGGGCCCGGATTTCCTTTGGATTTCTCGAGAAATCCAAAGGAAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-2080s1c1
Sequence:CCGGCCACTCTATGTTCTGGACCAACTCGAGTTGGTCCAGAACATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130954.3-1948s1c1
Sequence:CCGGTCTGAGAACTTGCCACCGTATCTCGAGATACGGTGGCAAGTTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-947s1c1
Sequence:CCGGCCCAGAACATAATGGACACCTCTCGAGAGGTGTCCATTATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130954.3-1409s1c1
Sequence:CCGGGCAACGTAGCTACGTTCAATTCTCGAGAATTGAACGTAGCTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130954
VALIDATED
SLC27A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 27 (fatty acid transporter), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-650s1c1
Sequence:CCGGGCCCGGATTTCCTTTGGATTTCTCGAGAAATCCAAAGGAAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-2080s1c1
Sequence:CCGGCCACTCTATGTTCTGGACCAACTCGAGTTGGTCCAGAACATAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130954.3-1948s1c1
Sequence:CCGGTCTGAGAACTTGCCACCGTATCTCGAGATACGGTGGCAAGTTCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130954.3-947s1c1
Sequence:CCGGCCCAGAACATAATGGACACCTCTCGAGAGGTGTCCATTATGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130954.3-1409s1c1
Sequence:CCGGGCAACGTAGCTACGTTCAATTCTCGAGAATTGAACGTAGCTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks