EMAIL THIS PAGE TO A FRIEND

SLC27A6

solute carrier family 27 (fatty acid transporter), member 6

Synonyms: ACSVL2 FACVL2 FATP6 VLCS-H1
UniProtKB ID: Q9Y2P4, Q6IAM5, Q7Z6E6, Q86YF6
Gene ID:
Human(28965) Summary: This gene encodes a member of the fatty acid transport protein family (FATP). FATPs are involved in the uptake of long-chain fatty acids and have unique expression patterns. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(225579) solute carrier family 27 (fatty acid transporter), member 6
Rat(291582) solute carrier family 27 (fatty acid transporter), member 6
cow(537062) solute carrier family 27 (fatty acid transporter), member 6
sheep(101104743) solute carrier family 27 (fatty acid transporter), member 6
Domestic Rabbit(100349387) solute carrier family 27 (fatty acid transporter), member 6
naked mole-rat(101702783) solute carrier family 27 (fatty acid transporter), member 6
domestic guinea pig(100714054) solute carrier family 27 (fatty acid transporter), member 6
Zebrafish(568835) solute carrier family 27 (fatty acid transporter), member 6
chicken(769933) solute carrier family 27 (fatty acid transporter), member 6
dog(474666) solute carrier family 27 (fatty acid transporter), member 6
domestic cat(101089323) solute carrier family 27 (fatty acid transporter), member 6
Horse(100063461) solute carrier family 27 (fatty acid transporter), member 6
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014031 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080191 MISSION® esiRNA esiRNA human SLC27A6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017372 Rosetta Predictions human pricing
NM_014031 Rosetta Predictions human pricing
NM_001106145 Rosetta Predictions rat pricing
NM_001081072 Rosetta Predictions mouse pricing
XM_128932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119176 predicted 2378
2 SASI_Hs01_00119178 predicted 693
3 SASI_Hs01_00119179 predicted 950
4 SASI_Hs02_00306710 predicted 2305
5 SASI_Hs01_00119180 predicted 1284
6 SASI_Hs02_00306711 predicted 906
7 SASI_Hs02_00306712 predicted 2209
8 SASI_Hs01_00119182 predicted 2420
9 SASI_Hs01_00119183 predicted 849
10 SASI_Hs01_00119184 predicted 1091
11 SASI_Hs01_00119177 predicted 2190
12 SASI_Hs01_00119181 predicted 1710
13 SASI_Hs01_00119185 predicted 2158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125394 predicted 2155
2 SASI_Hs01_00125396 predicted 476
3 SASI_Hs01_00125397 predicted 734
4 SASI_Hs02_00345014 predicted 2087
5 SASI_Hs01_00125398 predicted 1062
6 SASI_Hs02_00345015 predicted 686
7 SASI_Hs02_00345016 predicted 1985
8 SASI_Hs01_00125400 predicted 2195
9 SASI_Hs01_00125401 predicted 627
10 SASI_Hs01_00125402 predicted 871
11 SASI_Hs01_00125395 predicted 1962
12 SASI_Hs01_00125399 predicted 1488
13 SASI_Hs01_00125403 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216068 predicted 1161
2 SASI_Rn02_00216069 predicted 2073
3 SASI_Rn02_00216070 predicted 1807
4 SASI_Rn02_00216071 predicted 1507
5 SASI_Rn02_00216072 predicted 2165
6 SASI_Rn02_00216073 predicted 2118
7 SASI_Rn02_00216074 predicted 1624
8 SASI_Rn02_00216075 predicted 1971
9 SASI_Rn02_00216076 predicted 1873
10 SASI_Rn02_00216077 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294901 predicted 293
2 SASI_Mm02_00294902 predicted 1345
3 SASI_Mm02_00294903 predicted 1402
4 SASI_Mm02_00294904 predicted 786
5 SASI_Mm02_00294905 predicted 701
6 SASI_Mm02_00294906 predicted 1564
7 SASI_Mm02_00294907 predicted 1363
8 SASI_Mm02_00294908 predicted 924
9 SASI_Mm02_00294909 predicted 1705
10 SASI_Mm02_00294910 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251491 predicted 1166
2 SASI_Mm01_00251492 predicted 296
3 SASI_Mm01_00251493 predicted 875
4 SASI_Mm01_00251494 predicted 274
5 SASI_Mm01_00251495 predicted 788
6 SASI_Mm01_00251496 predicted 708
7 SASI_Mm01_00251497 predicted 921
8 SASI_Mm01_00251498 predicted 585
9 SASI_Mm01_00251499 predicted 341
10 SASI_Mm01_00251500 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128932
SLC27A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 27 (fatty acid transporter), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-866s1c1
Sequence:CCGGCCTCAAGTCTACTTGCCTCTACTCGAGTAGAGGCAAGTAGACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1991s1c1
Sequence:CCGGCCCGCTTTACTTTATGGATAACTCGAGTTATCCATAAAGTAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-296s1c1
Sequence:CCGGCCCGTATTTCTGGGATGATTTCTCGAGAAATCATCCCAGAAATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1075s1c1
Sequence:CCGGCGTGTGTGCTAAAGAAGAAATCTCGAGATTTCTTCTTTAGCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1493s1c1
Sequence:CCGGCCTCATTTCTCGTGTGAATAACTCGAGTTATTCACACGAGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128932
SLC27A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 27 (fatty acid transporter), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-866s1c1
Sequence:CCGGCCTCAAGTCTACTTGCCTCTACTCGAGTAGAGGCAAGTAGACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1991s1c1
Sequence:CCGGCCCGCTTTACTTTATGGATAACTCGAGTTATCCATAAAGTAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-296s1c1
Sequence:CCGGCCCGTATTTCTGGGATGATTTCTCGAGAAATCATCCCAGAAATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1075s1c1
Sequence:CCGGCGTGTGTGCTAAAGAAGAAATCTCGAGATTTCTTCTTTAGCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1493s1c1
Sequence:CCGGCCTCATTTCTCGTGTGAATAACTCGAGTTATTCACACGAGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128932
SLC27A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 27 (fatty acid transporter), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-866s1c1
Sequence:CCGGCCTCAAGTCTACTTGCCTCTACTCGAGTAGAGGCAAGTAGACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1991s1c1
Sequence:CCGGCCCGCTTTACTTTATGGATAACTCGAGTTATCCATAAAGTAAAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-296s1c1
Sequence:CCGGCCCGTATTTCTGGGATGATTTCTCGAGAAATCATCCCAGAAATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1075s1c1
Sequence:CCGGCGTGTGTGCTAAAGAAGAAATCTCGAGATTTCTTCTTTAGCACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128932.2-1493s1c1
Sequence:CCGGCCTCATTTCTCGTGTGAATAACTCGAGTTATTCACACGAGAAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014031
SLC27A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 27 (fatty acid transporter), member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-1773s1c1
Sequence:CCGGCCTTAATACTGGAGACTTAATCTCGAGATTAAGTCTCCAGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-1191s1c1
Sequence:CCGGGTATCATAGTTCAGCAGCTATCTCGAGATAGCTGCTGAACTATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-2210s1c1
Sequence:CCGGCCAGGGAACTTTATGATCAAACTCGAGTTTGATCATAAAGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-674s1c1
Sequence:CCGGCCCATGTCTTCCTGAACCATTCTCGAGAATGGTTCAGGAAGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-510s1c1
Sequence:CCGGGCTCATTATAATTCGGCTGAACTCGAGTTCAGCCGAATTATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014031.3-2047s21c1
Sequence:CCGGGCTTATGCTTGTCCACGATTTCTCGAGAAATCGTGGACAAGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014031.3-1481s21c1
Sequence:CCGGCAGCTACCGAATCAAGCATATCTCGAGATATGCTTGATTCGGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014031
SLC27A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 27 (fatty acid transporter), member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-1773s1c1
Sequence:CCGGCCTTAATACTGGAGACTTAATCTCGAGATTAAGTCTCCAGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-1191s1c1
Sequence:CCGGGTATCATAGTTCAGCAGCTATCTCGAGATAGCTGCTGAACTATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-2210s1c1
Sequence:CCGGCCAGGGAACTTTATGATCAAACTCGAGTTTGATCATAAAGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-674s1c1
Sequence:CCGGCCCATGTCTTCCTGAACCATTCTCGAGAATGGTTCAGGAAGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-510s1c1
Sequence:CCGGGCTCATTATAATTCGGCTGAACTCGAGTTCAGCCGAATTATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014031.3-2047s21c1
Sequence:CCGGGCTTATGCTTGTCCACGATTTCTCGAGAAATCGTGGACAAGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014031.3-1481s21c1
Sequence:CCGGCAGCTACCGAATCAAGCATATCTCGAGATATGCTTGATTCGGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014031
SLC27A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 27 (fatty acid transporter), member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-1773s1c1
Sequence:CCGGCCTTAATACTGGAGACTTAATCTCGAGATTAAGTCTCCAGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-1191s1c1
Sequence:CCGGGTATCATAGTTCAGCAGCTATCTCGAGATAGCTGCTGAACTATGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-2210s1c1
Sequence:CCGGCCAGGGAACTTTATGATCAAACTCGAGTTTGATCATAAAGTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-674s1c1
Sequence:CCGGCCCATGTCTTCCTGAACCATTCTCGAGAATGGTTCAGGAAGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014031.2-510s1c1
Sequence:CCGGGCTCATTATAATTCGGCTGAACTCGAGTTCAGCCGAATTATAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014031.3-2047s21c1
Sequence:CCGGGCTTATGCTTGTCCACGATTTCTCGAGAAATCGTGGACAAGCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014031.3-1481s21c1
Sequence:CCGGCAGCTACCGAATCAAGCATATCTCGAGATATGCTTGATTCGGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks