EMAIL THIS PAGE TO A FRIEND

SLC2A12

solute carrier family 2 (facilitated glucose transporter), member 12

Synonyms: GLUT12 GLUT8
UniProtKB ID: Q8TD20, B3KV17, Q7Z6U3, Q96MR8
Gene ID:
Human(154091) Summary: SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]
Mouse(353169) solute carrier family 2 (facilitated glucose transporter), member 12
Rat(308028) solute carrier family 2 (facilitated glucose transporter), member 12
Zebrafish(393510) solute carrier family 2 (facilitated glucose transporter), member 12
domestic cat(101098713) solute carrier family 2 (facilitated glucose transporter), member 12
dog(483994) solute carrier family 2 (facilitated glucose transporter), member 12
chicken(421696) solute carrier family 2 (facilitated glucose transporter), member 12
domestic guinea pig(100719777) solute carrier family 2 (facilitated glucose transporter), member 12
naked mole-rat(101709652) solute carrier family 2 (facilitated glucose transporter), member 12
Domestic Rabbit(100337737) solute carrier family 2 (facilitated glucose transporter), member 12
cow(497031) solute carrier family 2 (facilitated glucose transporter), member 12
sheep(101107449) solute carrier family 2 (facilitated glucose transporter), member 12
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145176 Rosetta Predictions human pricing
NM_001107451 Rosetta Predictions rat pricing
NM_178934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218059 predicted 541
2 SASI_Hs02_00365034 predicted 980
3 SASI_Hs01_00218061 predicted 757
4 SASI_Hs01_00218062 predicted 332
5 SASI_Hs01_00218063 predicted 681
6 SASI_Hs02_00365035 predicted 1078
7 SASI_Hs01_00218064 predicted 527
8 SASI_Hs01_00218065 predicted 616
9 SASI_Hs01_00218066 predicted 556
10 SASI_Hs01_00218067 predicted 1820
11 SASI_Hs01_00218060 predicted 1671
12 SASI_Hs01_00218068 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228955 predicted 484
2 SASI_Rn02_00228956 predicted 921
3 SASI_Rn02_00228957 predicted 1834
4 SASI_Rn02_00228958 predicted 845
5 SASI_Rn02_00228959 predicted 635
6 SASI_Rn02_00228960 predicted 1649
7 SASI_Rn02_00228961 predicted 341
8 SASI_Rn02_00228962 predicted 900
9 SASI_Rn02_00228963 predicted 1850
10 SASI_Rn02_00228964 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123332 predicted 818
2 SASI_Mm01_00123333 predicted 242
3 SASI_Mm01_00123334 predicted 837
4 SASI_Mm02_00349568 predicted 908
5 SASI_Mm01_00123335 predicted 386
6 SASI_Mm01_00123336 predicted 1908
7 SASI_Mm01_00123337 predicted 1731
8 SASI_Mm02_00349569 predicted 779
9 SASI_Mm01_00123338 predicted 705
10 SASI_Mm01_00123340 predicted 1268
11 SASI_Mm01_00123339 predicted 401
12 SASI_Mm01_00123341 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145176
SLC2A12 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145176.1-2470s1c1
Sequence:CCGGGCCCATATATTCTATCTAGATCTCGAGATCTAGATAGAATATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-1395s1c1
Sequence:CCGGCCCTGAGAAATGATGTGGATACTCGAGTATCCACATCATTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-664s1c1
Sequence:CCGGCGGCATTCTTTCTGCCTATATCTCGAGATATAGGCAGAAAGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-963s1c1
Sequence:CCGGCCCGAATAATGATAGGACTAACTCGAGTTAGTCCTATCATTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-1440s1c1
Sequence:CCGGCCTTGCTAAATGCTGGATTAACTCGAGTTAATCCAGCATTTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145176
SLC2A12 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145176.1-2470s1c1
Sequence:CCGGGCCCATATATTCTATCTAGATCTCGAGATCTAGATAGAATATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-1395s1c1
Sequence:CCGGCCCTGAGAAATGATGTGGATACTCGAGTATCCACATCATTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-664s1c1
Sequence:CCGGCGGCATTCTTTCTGCCTATATCTCGAGATATAGGCAGAAAGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-963s1c1
Sequence:CCGGCCCGAATAATGATAGGACTAACTCGAGTTAGTCCTATCATTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-1440s1c1
Sequence:CCGGCCTTGCTAAATGCTGGATTAACTCGAGTTAATCCAGCATTTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145176
SLC2A12 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145176.1-2470s1c1
Sequence:CCGGGCCCATATATTCTATCTAGATCTCGAGATCTAGATAGAATATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-1395s1c1
Sequence:CCGGCCCTGAGAAATGATGTGGATACTCGAGTATCCACATCATTTCTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-664s1c1
Sequence:CCGGCGGCATTCTTTCTGCCTATATCTCGAGATATAGGCAGAAAGAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-963s1c1
Sequence:CCGGCCCGAATAATGATAGGACTAACTCGAGTTAGTCCTATCATTATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145176.1-1440s1c1
Sequence:CCGGCCTTGCTAAATGCTGGATTAACTCGAGTTAATCCAGCATTTAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178934
SLC2A12 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-960s1c1
Sequence:CCGGGCAGCCAAACATACTATTCTACTCGAGTAGAATAGTATGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-708s1c1
Sequence:CCGGGCAAGCAATAGCGATGTACTTCTCGAGAAGTACATCGCTATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-598s1c1
Sequence:CCGGCTGATGATTGTCACTGGTATTCTCGAGAATACCAGTGACAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-1649s1c1
Sequence:CCGGCTGATCTTATTGGTTTGTCATCTCGAGATGACAAACCAATAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-1777s1c1
Sequence:CCGGGCAAAGGCGAACTATGTGAAACTCGAGTTTCACATAGTTCGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178934
SLC2A12 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-960s1c1
Sequence:CCGGGCAGCCAAACATACTATTCTACTCGAGTAGAATAGTATGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-708s1c1
Sequence:CCGGGCAAGCAATAGCGATGTACTTCTCGAGAAGTACATCGCTATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-598s1c1
Sequence:CCGGCTGATGATTGTCACTGGTATTCTCGAGAATACCAGTGACAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-1649s1c1
Sequence:CCGGCTGATCTTATTGGTTTGTCATCTCGAGATGACAAACCAATAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-1777s1c1
Sequence:CCGGGCAAAGGCGAACTATGTGAAACTCGAGTTTCACATAGTTCGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178934
SLC2A12 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-960s1c1
Sequence:CCGGGCAGCCAAACATACTATTCTACTCGAGTAGAATAGTATGTTTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-708s1c1
Sequence:CCGGGCAAGCAATAGCGATGTACTTCTCGAGAAGTACATCGCTATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-598s1c1
Sequence:CCGGCTGATGATTGTCACTGGTATTCTCGAGAATACCAGTGACAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-1649s1c1
Sequence:CCGGCTGATCTTATTGGTTTGTCATCTCGAGATGACAAACCAATAAGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178934.2-1777s1c1
Sequence:CCGGGCAAAGGCGAACTATGTGAAACTCGAGTTTCACATAGTTCGCCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks