EMAIL THIS PAGE TO A FRIEND

SLC2A1

solute carrier family 2 (facilitated glucose transporter), member 1

Synonyms: DYT17 DYT18 DYT9 EIG12 GLUT GLUT1 GLUT1DS HTLVR PED
UniProtKB ID: P11166, A8K9S6, B2R620, D3DPX0, O75535, Q147X2
Gene ID:
Human(6513) Summary: This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]
Mouse(20525) solute carrier family 2 (facilitated glucose transporter), member 1
Rat(24778) solute carrier family 2 (facilitated glucose transporter), member 1
chicken(396130) solute carrier family 2 (facilitated glucose transporter), member 1
Horse(100034080) solute carrier family 2 (facilitated glucose transporter), member 1
dog(482437) solute carrier family 2 (facilitated glucose transporter), member 1
domestic cat(100127104) solute carrier family 2 (facilitated glucose transporter), member 1
cow(282356) solute carrier family 2 (facilitated glucose transporter), member 1
naked mole-rat(101697875) solute carrier family 2 (facilitated glucose transporter), member 1
Domestic Rabbit(100125988) solute carrier family 2 (facilitated glucose transporter), member 1
domestic guinea pig(100715554) solute carrier family 2 (facilitated glucose transporter), member 1
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C1172 ML-9 ≥99% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006516 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006516 siRNAs that have been validated in the lab human pricing
NM_138827 Rosetta Predictions rat pricing
NM_011400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006516 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028732 validated 554
2 SASI_Hs02_00341744 predicted 1476
3 SASI_Hs02_00341745 predicted 1594
4 SASI_Hs02_00341746 predicted 1786
5 SASI_Hs02_00341747 predicted 1188
6 SASI_Hs01_00028734 predicted 940
7 SASI_Hs02_00341748 predicted 1815
8 SASI_Hs02_00341749 predicted 1890
9 SASI_Hs02_00341750 predicted 1803
10 SASI_Hs02_00341751 predicted 846
11 SASI_Hs02_00341752 predicted 782
12 SASI_Hs01_00028733 predicted 454
13 SASI_Hs01_00028735 predicted 1038
14 SASI_Hs01_00028736 predicted 1345
15 SASI_Hs01_00028737 predicted 313
16 SASI_Hs01_00028738 predicted 1517
17 SASI_Hs01_00028739 predicted 604
18 SASI_Hs01_00028740 predicted 1423
19 SASI_Hs01_00028741 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041864 predicted 281
2 SASI_Rn01_00041865 predicted 739
3 SASI_Rn01_00041866 predicted 522
4 SASI_Rn01_00041867 predicted 319
5 SASI_Rn01_00041868 predicted 507
6 SASI_Rn01_00041869 predicted 759
7 SASI_Rn01_00041870 predicted 1305
8 SASI_Rn01_00041871 predicted 1542
9 SASI_Rn01_00041872 predicted 1430
10 SASI_Rn01_00041873 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068163 predicted 735
2 SASI_Mm01_00068164 predicted 317
3 SASI_Mm02_00320609 predicted 584
4 SASI_Mm01_00068166 predicted 273
5 SASI_Mm01_00068167 predicted 510
6 SASI_Mm01_00068168 predicted 533
7 SASI_Mm02_00320610 predicted 624
8 SASI_Mm02_00320611 predicted 1415
9 SASI_Mm01_00068170 predicted 441
10 SASI_Mm01_00068171 predicted 888
11 SASI_Mm01_00068165 predicted 267
12 SASI_Mm01_00068169 predicted 1394
13 SASI_Mm01_00068172 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011400
VALIDATED
SLC2A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-690s1c1
Sequence:CCGGCATCCTTATTGCCCAGGTGTTCTCGAGAACACCTGGGCAATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-267s1c1
Sequence:CCGGCGGCTATAACACTGGTGTCATCTCGAGATGACACCAGTGTTATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011400.1-438s1c1
Sequence:CCGGCGGCCTCTTTGTTAATCGCTTCTCGAGAAGCGATTAACAAAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-2356s1c1
Sequence:CCGGGCTGAGAACTTAACTGCTGAACTCGAGTTCAGCAGTTAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011400.1-1041s1c1
Sequence:CCGGGTCGGGTATCAATGCTGTGTTCTCGAGAACACAGCATTGATACCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-330s21c1
Sequence:CCGGTGAGGAGTTCTACAATCAAACCTCGAGGTTTGATTGTAGAACTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011400.3-1169s21c1
Sequence:CCGGTCACTGTGGTGTCGCTGTTTGCTCGAGCAAACAGCGACACCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-1361s21c1
Sequence:CCGGGTCCTATTCCATGGTTCATTGCTCGAGCAATGAACCATGGAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-2378s21c1
Sequence:CCGGGCTGAGAACTTAACTGCTGAACTCGAGTTCAGCAGTTAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011400.3-711s21c1
Sequence:CCGGCATCCTTATTGCCCAGGTGTTCTCGAGAACACCTGGGCAATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011400
VALIDATED
SLC2A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-690s1c1
Sequence:CCGGCATCCTTATTGCCCAGGTGTTCTCGAGAACACCTGGGCAATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-267s1c1
Sequence:CCGGCGGCTATAACACTGGTGTCATCTCGAGATGACACCAGTGTTATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011400.1-438s1c1
Sequence:CCGGCGGCCTCTTTGTTAATCGCTTCTCGAGAAGCGATTAACAAAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-2356s1c1
Sequence:CCGGGCTGAGAACTTAACTGCTGAACTCGAGTTCAGCAGTTAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011400.1-1041s1c1
Sequence:CCGGGTCGGGTATCAATGCTGTGTTCTCGAGAACACAGCATTGATACCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-330s21c1
Sequence:CCGGTGAGGAGTTCTACAATCAAACCTCGAGGTTTGATTGTAGAACTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011400.3-1169s21c1
Sequence:CCGGTCACTGTGGTGTCGCTGTTTGCTCGAGCAAACAGCGACACCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-1361s21c1
Sequence:CCGGGTCCTATTCCATGGTTCATTGCTCGAGCAATGAACCATGGAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-2378s21c1
Sequence:CCGGGCTGAGAACTTAACTGCTGAACTCGAGTTCAGCAGTTAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011400.3-711s21c1
Sequence:CCGGCATCCTTATTGCCCAGGTGTTCTCGAGAACACCTGGGCAATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011400
VALIDATED
SLC2A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-690s1c1
Sequence:CCGGCATCCTTATTGCCCAGGTGTTCTCGAGAACACCTGGGCAATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-267s1c1
Sequence:CCGGCGGCTATAACACTGGTGTCATCTCGAGATGACACCAGTGTTATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011400.1-438s1c1
Sequence:CCGGCGGCCTCTTTGTTAATCGCTTCTCGAGAAGCGATTAACAAAGAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011400.1-2356s1c1
Sequence:CCGGGCTGAGAACTTAACTGCTGAACTCGAGTTCAGCAGTTAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011400.1-1041s1c1
Sequence:CCGGGTCGGGTATCAATGCTGTGTTCTCGAGAACACAGCATTGATACCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-330s21c1
Sequence:CCGGTGAGGAGTTCTACAATCAAACCTCGAGGTTTGATTGTAGAACTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011400.3-1169s21c1
Sequence:CCGGTCACTGTGGTGTCGCTGTTTGCTCGAGCAAACAGCGACACCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-1361s21c1
Sequence:CCGGGTCCTATTCCATGGTTCATTGCTCGAGCAATGAACCATGGAATAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011400.3-2378s21c1
Sequence:CCGGGCTGAGAACTTAACTGCTGAACTCGAGTTCAGCAGTTAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011400.3-711s21c1
Sequence:CCGGCATCCTTATTGCCCAGGTGTTCTCGAGAACACCTGGGCAATAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006516
SLC2A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 2 (facilitated glucose transporter), member 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006516.1-2310s1c1
Sequence:CCGGGCCACACTATTACCATGAGAACTCGAGTTCTCATGGTAATAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-455s1c1
Sequence:CCGGGCGGAATTCAATGCTGATGATCTCGAGATCATCAGCATTGAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1049s1c1
Sequence:CCGGCTTCTATTACTCCACGAGCATCTCGAGATGCTCGTGGAGTAATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1526s1c1
Sequence:CCGGCTTCAAAGTTCCTGAGACTAACTCGAGTTAGTCTCAGGAACTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1598s1c1
Sequence:CCGGCCAAAGTGATAAGACACCCGACTCGAGTCGGGTGTCTTATCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1809s21c1
Sequence:CCGGGTGTGGTCCCTACGTCTTCATCTCGAGATGAAGACGTAGGGACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-635s21c1
Sequence:CCGGAGAAGGTGATCGAGGAGTTCTCTCGAGAGAACTCCTCGATCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-900s21c1
Sequence:CCGGCCGCTTCATCATCGGTGTGTACTCGAGTACACACCGATGATGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-850s21c1
Sequence:CCGGCTCATGGGCTTCTCGAAACTGCTCGAGCAGTTTCGAGAAGCCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1778s21c1
Sequence:CCGGTGGGCATGTGCTTCCAGTATGCTCGAGCATACTGGAAGCACATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1625s21c1
Sequence:CCGGTGAGCATCGTGGCCATCTTTGCTCGAGCAAAGATGGCCACGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006516.2-2195s21c1
Sequence:CCGGAGACTGTTGCTCAAATCTATTCTCGAGAATAGATTTGAGCAACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1457s21c1
Sequence:CCGGTTGGCTCCGGTATCGTCAACACTCGAGTGTTGACGATACCGGAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1752s21c1
Sequence:CCGGCTCCAACTGGACCTCAAATTTCTCGAGAAATTTGAGGTCCAGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006516
SLC2A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 2 (facilitated glucose transporter), member 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006516.1-2310s1c1
Sequence:CCGGGCCACACTATTACCATGAGAACTCGAGTTCTCATGGTAATAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-455s1c1
Sequence:CCGGGCGGAATTCAATGCTGATGATCTCGAGATCATCAGCATTGAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1049s1c1
Sequence:CCGGCTTCTATTACTCCACGAGCATCTCGAGATGCTCGTGGAGTAATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1526s1c1
Sequence:CCGGCTTCAAAGTTCCTGAGACTAACTCGAGTTAGTCTCAGGAACTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1598s1c1
Sequence:CCGGCCAAAGTGATAAGACACCCGACTCGAGTCGGGTGTCTTATCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1809s21c1
Sequence:CCGGGTGTGGTCCCTACGTCTTCATCTCGAGATGAAGACGTAGGGACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-635s21c1
Sequence:CCGGAGAAGGTGATCGAGGAGTTCTCTCGAGAGAACTCCTCGATCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-900s21c1
Sequence:CCGGCCGCTTCATCATCGGTGTGTACTCGAGTACACACCGATGATGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-850s21c1
Sequence:CCGGCTCATGGGCTTCTCGAAACTGCTCGAGCAGTTTCGAGAAGCCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1778s21c1
Sequence:CCGGTGGGCATGTGCTTCCAGTATGCTCGAGCATACTGGAAGCACATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1625s21c1
Sequence:CCGGTGAGCATCGTGGCCATCTTTGCTCGAGCAAAGATGGCCACGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006516.2-2195s21c1
Sequence:CCGGAGACTGTTGCTCAAATCTATTCTCGAGAATAGATTTGAGCAACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1457s21c1
Sequence:CCGGTTGGCTCCGGTATCGTCAACACTCGAGTGTTGACGATACCGGAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1752s21c1
Sequence:CCGGCTCCAACTGGACCTCAAATTTCTCGAGAAATTTGAGGTCCAGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006516
SLC2A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 2 (facilitated glucose transporter), member 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006516.1-2310s1c1
Sequence:CCGGGCCACACTATTACCATGAGAACTCGAGTTCTCATGGTAATAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-455s1c1
Sequence:CCGGGCGGAATTCAATGCTGATGATCTCGAGATCATCAGCATTGAATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1049s1c1
Sequence:CCGGCTTCTATTACTCCACGAGCATCTCGAGATGCTCGTGGAGTAATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1526s1c1
Sequence:CCGGCTTCAAAGTTCCTGAGACTAACTCGAGTTAGTCTCAGGAACTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006516.1-1598s1c1
Sequence:CCGGCCAAAGTGATAAGACACCCGACTCGAGTCGGGTGTCTTATCACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1809s21c1
Sequence:CCGGGTGTGGTCCCTACGTCTTCATCTCGAGATGAAGACGTAGGGACCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-635s21c1
Sequence:CCGGAGAAGGTGATCGAGGAGTTCTCTCGAGAGAACTCCTCGATCACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-900s21c1
Sequence:CCGGCCGCTTCATCATCGGTGTGTACTCGAGTACACACCGATGATGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-850s21c1
Sequence:CCGGCTCATGGGCTTCTCGAAACTGCTCGAGCAGTTTCGAGAAGCCCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1778s21c1
Sequence:CCGGTGGGCATGTGCTTCCAGTATGCTCGAGCATACTGGAAGCACATGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1625s21c1
Sequence:CCGGTGAGCATCGTGGCCATCTTTGCTCGAGCAAAGATGGCCACGATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006516.2-2195s21c1
Sequence:CCGGAGACTGTTGCTCAAATCTATTCTCGAGAATAGATTTGAGCAACAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1457s21c1
Sequence:CCGGTTGGCTCCGGTATCGTCAACACTCGAGTGTTGACGATACCGGAGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006516.2-1752s21c1
Sequence:CCGGCTCCAACTGGACCTCAAATTTCTCGAGAAATTTGAGGTCCAGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks