EMAIL THIS PAGE TO A FRIEND

SLC30A1

solute carrier family 30 (zinc transporter), member 1

Synonyms: ZNT1 ZRC1
UniProtKB ID: Q9Y6M5, Q0VAK9, Q9BZF6
Gene ID:
Mouse(22782) solute carrier family 30 (zinc transporter), member 1
Rat(58976) solute carrier family 30 (zinc transporter), member 1
chicken(421377) solute carrier family 30 (zinc transporter), member 1
domestic cat(101092161) solute carrier family 30 (zinc transporter), member 1
dog(100286799) solute carrier family 30 (zinc transporter), member 1
domestic guinea pig(100723752) solute carrier family 30 (zinc transporter), member 1
cow(522265) solute carrier family 30 (zinc transporter), member 1
sheep(101103912) solute carrier family 30 (zinc transporter), member 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021194 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU078121 MISSION® esiRNA esiRNA targeting mouse Slc30a1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021194 siRNAs that have been validated in the lab human pricing
NM_022853 Rosetta Predictions rat pricing
NM_009579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021194 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118238 validated 1183
2 SASI_Hs01_00118239 predicted 1106
3 SASI_Hs02_00354773 predicted 1741
4 SASI_Hs01_00118240 predicted 1531
5 SASI_Hs01_00118244 predicted 792
6 SASI_Hs01_00118245 predicted 1008
7 SASI_Hs02_00354774 predicted 1758
8 SASI_Hs02_00354775 predicted 865
9 SASI_Hs01_00118246 predicted 1192
10 SASI_Hs02_00354776 predicted 398
11 SASI_Hs01_00118247 predicted 1648
12 SASI_Hs01_00118241 predicted 1398
13 SASI_Hs01_00118242 predicted 923
14 SASI_Hs01_00118243 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113671 predicted 1706
2 SASI_Rn01_00113672 predicted 1215
3 SASI_Rn02_00263567 predicted 1302
4 SASI_Rn01_00113673 predicted 1558
5 SASI_Rn01_00113675 predicted 1126
6 SASI_Rn01_00113676 predicted 1664
7 SASI_Rn01_00113677 predicted 1113
8 SASI_Rn01_00113678 predicted 1606
9 SASI_Rn01_00113679 predicted 907
10 SASI_Rn01_00113680 predicted 1745
11 SASI_Rn01_00113674 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103414 predicted 1812
2 SASI_Mm01_00103415 predicted 1794
3 SASI_Mm01_00103416 predicted 1167
4 SASI_Mm01_00103417 predicted 1599
5 SASI_Mm01_00103418 predicted 993
6 SASI_Mm01_00103419 predicted 1201
7 SASI_Mm02_00316472 predicted 1162
8 SASI_Mm01_00103421 predicted 1257
9 SASI_Mm01_00103422 predicted 1081
10 SASI_Mm02_00316473 predicted 1711
11 SASI_Mm01_00103413 predicted 1415
12 SASI_Mm01_00103420 predicted 1659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009579
SLC30A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 30 (zinc transporter), member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009579.2-1905s1c1
Sequence:CCGGGCCTTGTGATTCTTAGTGCATCTCGAGATGCACTAAGAATCACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1587s1c1
Sequence:CCGGCGCCAACAGTTAGCATTTCTTCTCGAGAAGAAATGCTAACTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-928s1c1
Sequence:CCGGGCTGAATATGCGAGGAGTGTTCTCGAGAACACTCCTCGCATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1153s1c1
Sequence:CCGGCCCAACCCTTTGTATTATAATCTCGAGATTATAATACAAAGGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1673s1c1
Sequence:CCGGGCTGTGGTGATAGAGATTAAACTCGAGTTTAATCTCTATCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009579.3-859s21c1
Sequence:CCGGCCCAGTGGATGTACAAGTAAACTCGAGTTTACTTGTACATCCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009579.3-1846s21c1
Sequence:CCGGGTCGCACAGTTTAATTCTATTCTCGAGAATAGAATTAAACTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009579.3-2205s21c1
Sequence:CCGGGCTTGCCCTTTGAGATCATAACTCGAGTTATGATCTCAAAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009579
SLC30A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 30 (zinc transporter), member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009579.2-1905s1c1
Sequence:CCGGGCCTTGTGATTCTTAGTGCATCTCGAGATGCACTAAGAATCACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1587s1c1
Sequence:CCGGCGCCAACAGTTAGCATTTCTTCTCGAGAAGAAATGCTAACTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-928s1c1
Sequence:CCGGGCTGAATATGCGAGGAGTGTTCTCGAGAACACTCCTCGCATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1153s1c1
Sequence:CCGGCCCAACCCTTTGTATTATAATCTCGAGATTATAATACAAAGGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1673s1c1
Sequence:CCGGGCTGTGGTGATAGAGATTAAACTCGAGTTTAATCTCTATCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009579.3-859s21c1
Sequence:CCGGCCCAGTGGATGTACAAGTAAACTCGAGTTTACTTGTACATCCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009579.3-1846s21c1
Sequence:CCGGGTCGCACAGTTTAATTCTATTCTCGAGAATAGAATTAAACTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009579.3-2205s21c1
Sequence:CCGGGCTTGCCCTTTGAGATCATAACTCGAGTTATGATCTCAAAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009579
SLC30A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 30 (zinc transporter), member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009579.2-1905s1c1
Sequence:CCGGGCCTTGTGATTCTTAGTGCATCTCGAGATGCACTAAGAATCACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1587s1c1
Sequence:CCGGCGCCAACAGTTAGCATTTCTTCTCGAGAAGAAATGCTAACTGTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-928s1c1
Sequence:CCGGGCTGAATATGCGAGGAGTGTTCTCGAGAACACTCCTCGCATATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1153s1c1
Sequence:CCGGCCCAACCCTTTGTATTATAATCTCGAGATTATAATACAAAGGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009579.2-1673s1c1
Sequence:CCGGGCTGTGGTGATAGAGATTAAACTCGAGTTTAATCTCTATCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009579.3-859s21c1
Sequence:CCGGCCCAGTGGATGTACAAGTAAACTCGAGTTTACTTGTACATCCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009579.3-1846s21c1
Sequence:CCGGGTCGCACAGTTTAATTCTATTCTCGAGAATAGAATTAAACTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009579.3-2205s21c1
Sequence:CCGGGCTTGCCCTTTGAGATCATAACTCGAGTTATGATCTCAAAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021194
VALIDATED
SLC30A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 30 (zinc transporter), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021194.1-869s1c1
Sequence:CCGGCCTGCAAAGCATTTGTAGAAACTCGAGTTTCTACAAATGCTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-1240s1c1
Sequence:CCGGGCTACTACCATTCAGCCTGAACTCGAGTTCAGGCTGAATGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-773s1c1
Sequence:CCGGGTTCAGTGATTGTAGTAGTAACTCGAGTTACTACTACAATCACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021194.1-655s1c1
Sequence:CCGGGAAGTACAAGTGAATGGAAATCTCGAGATTTCCATTCACTTGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-1360s1c1
Sequence:CCGGCCTTCTGGAAAGGATGCAGAACTCGAGTTCTGCATCCTTTCCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021194.2-1071s21c1
Sequence:CCGGGTCCTTGCTGGGTGCTATATTCTCGAGAATATAGCACCCAGCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021194.2-1135s21c1
Sequence:CCGGCACAACCTATCCATTACTTAACTCGAGTTAAGTAATGGATAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021194
VALIDATED
SLC30A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 30 (zinc transporter), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021194.1-869s1c1
Sequence:CCGGCCTGCAAAGCATTTGTAGAAACTCGAGTTTCTACAAATGCTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-1240s1c1
Sequence:CCGGGCTACTACCATTCAGCCTGAACTCGAGTTCAGGCTGAATGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-773s1c1
Sequence:CCGGGTTCAGTGATTGTAGTAGTAACTCGAGTTACTACTACAATCACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021194.1-655s1c1
Sequence:CCGGGAAGTACAAGTGAATGGAAATCTCGAGATTTCCATTCACTTGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-1360s1c1
Sequence:CCGGCCTTCTGGAAAGGATGCAGAACTCGAGTTCTGCATCCTTTCCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021194.2-1071s21c1
Sequence:CCGGGTCCTTGCTGGGTGCTATATTCTCGAGAATATAGCACCCAGCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021194.2-1135s21c1
Sequence:CCGGCACAACCTATCCATTACTTAACTCGAGTTAAGTAATGGATAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021194
VALIDATED
SLC30A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 30 (zinc transporter), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_021194.1-869s1c1
Sequence:CCGGCCTGCAAAGCATTTGTAGAAACTCGAGTTTCTACAAATGCTTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-1240s1c1
Sequence:CCGGGCTACTACCATTCAGCCTGAACTCGAGTTCAGGCTGAATGGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-773s1c1
Sequence:CCGGGTTCAGTGATTGTAGTAGTAACTCGAGTTACTACTACAATCACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021194.1-655s1c1
Sequence:CCGGGAAGTACAAGTGAATGGAAATCTCGAGATTTCCATTCACTTGTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021194.1-1360s1c1
Sequence:CCGGCCTTCTGGAAAGGATGCAGAACTCGAGTTCTGCATCCTTTCCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021194.2-1071s21c1
Sequence:CCGGGTCCTTGCTGGGTGCTATATTCTCGAGAATATAGCACCCAGCAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021194.2-1135s21c1
Sequence:CCGGCACAACCTATCCATTACTTAACTCGAGTTAAGTAATGGATAGGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks