EMAIL THIS PAGE TO A FRIEND

SLC32A1

solute carrier family 32 (GABA vesicular transporter), member 1

Synonyms: VGAT VIAAT
UniProtKB ID: Q9H598, Q8N489
Gene ID:
Human(140679) Summary: The protein encoded by this gene is an integral membrane protein involved in gamma-aminobutyric acid (GABA) and glycine uptake into synaptic vesicles. The encoded protein is a member of amino acid/polyamine transporter family II. [provided by RefSeq, Jul 2008]
Mouse(22348) solute carrier family 32 (GABA vesicular transporter), member 1
Rat(83612) solute carrier family 32 (GABA vesicular transporter), member 1
naked mole-rat(101725145) solute carrier family 32 (GABA vesicular transporter), member 1
domestic guinea pig(100732194) solute carrier family 32 (GABA vesicular transporter), member 1
cow(100301361) solute carrier family 32 (GABA vesicular transporter), member 1
sheep(101105268) solute carrier family 32 (GABA vesicular transporter), member 1
Zebrafish(798575) solute carrier family 32 (GABA vesicular transporter), member 1
domestic cat(101096880) solute carrier family 32 (GABA vesicular transporter), member 1
dog(485870) solute carrier family 32 (GABA vesicular transporter), member 1
chicken(419167) solute carrier family 32 (GABA vesicular transporter), member 1
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080552 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080552 Rosetta Predictions human pricing
NM_031782 Rosetta Predictions rat pricing
XM_001068818 Rosetta Predictions rat pricing
NM_009508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036216 predicted 1187
2 SASI_Hs01_00036217 predicted 1188
3 SASI_Hs02_00362313 predicted 901
4 SASI_Hs01_00036218 predicted 1255
5 SASI_Hs01_00036219 predicted 975
6 SASI_Hs01_00036220 predicted 1103
7 SASI_Hs01_00036221 predicted 395
8 SASI_Hs01_00036222 predicted 970
9 SASI_Hs01_00036224 predicted 1601
10 SASI_Hs01_00036225 predicted 872
11 SASI_Hs01_00036223 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092952 predicted 720
2 SASI_Rn01_00092954 predicted 799
3 SASI_Rn01_00092955 predicted 633
4 SASI_Rn01_00092956 predicted 710
5 SASI_Rn02_00265220 predicted 720
6 SASI_Rn01_00092957 predicted 628
7 SASI_Rn01_00092958 predicted 796
8 SASI_Rn02_00265221 predicted 708
9 SASI_Rn01_00092959 predicted 1420
10 SASI_Rn01_00092960 predicted 588
11 SASI_Rn01_00092953 predicted 253
12 SASI_Rn01_00092961 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325974 predicted 1121
2 SASI_Rn02_00325975 predicted 574
3 SASI_Rn02_00325976 predicted 1199
4 SASI_Rn02_00325977 predicted 1034
5 SASI_Rn02_00325978 predicted 1104
6 SASI_Rn02_00325979 predicted 1026
7 SASI_Rn02_00325980 predicted 1191
8 SASI_Rn02_00325981 predicted 1822
9 SASI_Rn02_00325982 predicted 985
10 SASI_Rn02_00325983 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120605 predicted 1117
2 SASI_Mm02_00316292 predicted 1480
3 SASI_Mm02_00316293 predicted 573
4 SASI_Mm01_00120606 predicted 1408
5 SASI_Mm01_00120607 predicted 1195
6 SASI_Mm02_00316294 predicted 2543
7 SASI_Mm01_00120609 predicted 1030
8 SASI_Mm01_00120611 predicted 2409
9 SASI_Mm01_00120613 predicted 1820
10 SASI_Mm02_00316295 predicted 1671
11 SASI_Mm01_00120608 predicted 972
12 SASI_Mm01_00120610 predicted 668
13 SASI_Mm01_00120612 predicted 885
14 SASI_Mm01_00120614 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009508
SLC32A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 32 (GABA vesicular transporter), member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009508.1-1719s1c1
Sequence:CCGGCCTGAAAGGTTGACCGGGAAACTCGAGTTTCCCGGTCAACCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-832s1c1
Sequence:CCGGCCAAGTTCAGTCTGCTGTGTACTCGAGTACACAGCAGACTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-677s1c1
Sequence:CCGGCGAGCTGGTGATGACGTGTATCTCGAGATACACGTCATCACCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-944s1c1
Sequence:CCGGCGACGTCAAGAAGTTTCCCATCTCGAGATGGGAAACTTCTTGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-680s1c1
Sequence:CCGGGCTGGTGATGACGTGTATCTTCTCGAGAAGATACACGTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009508
SLC32A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 32 (GABA vesicular transporter), member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009508.1-1719s1c1
Sequence:CCGGCCTGAAAGGTTGACCGGGAAACTCGAGTTTCCCGGTCAACCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-832s1c1
Sequence:CCGGCCAAGTTCAGTCTGCTGTGTACTCGAGTACACAGCAGACTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-677s1c1
Sequence:CCGGCGAGCTGGTGATGACGTGTATCTCGAGATACACGTCATCACCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-944s1c1
Sequence:CCGGCGACGTCAAGAAGTTTCCCATCTCGAGATGGGAAACTTCTTGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-680s1c1
Sequence:CCGGGCTGGTGATGACGTGTATCTTCTCGAGAAGATACACGTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009508
SLC32A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 32 (GABA vesicular transporter), member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009508.1-1719s1c1
Sequence:CCGGCCTGAAAGGTTGACCGGGAAACTCGAGTTTCCCGGTCAACCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-832s1c1
Sequence:CCGGCCAAGTTCAGTCTGCTGTGTACTCGAGTACACAGCAGACTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-677s1c1
Sequence:CCGGCGAGCTGGTGATGACGTGTATCTCGAGATACACGTCATCACCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-944s1c1
Sequence:CCGGCGACGTCAAGAAGTTTCCCATCTCGAGATGGGAAACTTCTTGACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009508.1-680s1c1
Sequence:CCGGGCTGGTGATGACGTGTATCTTCTCGAGAAGATACACGTCATCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080552
SLC32A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 32 (GABA vesicular transporter), member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1089s1c1
Sequence:CCGGGTCATCAATATCCTGGTCATACTCGAGTATGACCAGGATATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1804s1c1
Sequence:CCGGGCCTCATCGAAGCCTACCGAACTCGAGTTCGGTAGGCTTCGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-498s1c1
Sequence:CCGGGTCGAGGGAGACATCCATTATCTCGAGATAATGGATGTCTCCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1277s1c1
Sequence:CCGGCATGATGAACTGGACGCACATCTCGAGATGTGCGTCCAGTTCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-765s1c1
Sequence:CCGGGCGTGCCTGTACGAGGAGAATCTCGAGATTCTCCTCGTACAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080552.2-1961s21c1
Sequence:CCGGGTTCCTAGTTTCTGATTATTCCTCGAGGAATAATCAGAAACTAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080552
SLC32A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 32 (GABA vesicular transporter), member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1089s1c1
Sequence:CCGGGTCATCAATATCCTGGTCATACTCGAGTATGACCAGGATATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1804s1c1
Sequence:CCGGGCCTCATCGAAGCCTACCGAACTCGAGTTCGGTAGGCTTCGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-498s1c1
Sequence:CCGGGTCGAGGGAGACATCCATTATCTCGAGATAATGGATGTCTCCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1277s1c1
Sequence:CCGGCATGATGAACTGGACGCACATCTCGAGATGTGCGTCCAGTTCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-765s1c1
Sequence:CCGGGCGTGCCTGTACGAGGAGAATCTCGAGATTCTCCTCGTACAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080552.2-1961s21c1
Sequence:CCGGGTTCCTAGTTTCTGATTATTCCTCGAGGAATAATCAGAAACTAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080552
SLC32A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 32 (GABA vesicular transporter), member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1089s1c1
Sequence:CCGGGTCATCAATATCCTGGTCATACTCGAGTATGACCAGGATATTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1804s1c1
Sequence:CCGGGCCTCATCGAAGCCTACCGAACTCGAGTTCGGTAGGCTTCGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-498s1c1
Sequence:CCGGGTCGAGGGAGACATCCATTATCTCGAGATAATGGATGTCTCCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-1277s1c1
Sequence:CCGGCATGATGAACTGGACGCACATCTCGAGATGTGCGTCCAGTTCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080552.2-765s1c1
Sequence:CCGGGCGTGCCTGTACGAGGAGAATCTCGAGATTCTCCTCGTACAGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080552.2-1961s21c1
Sequence:CCGGGTTCCTAGTTTCTGATTATTCCTCGAGGAATAATCAGAAACTAGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks