EMAIL THIS PAGE TO A FRIEND

SLC34A2

solute carrier family 34 (type II sodium/phosphate contransporter), member 2

Synonyms: NAPI-3B NAPI-IIb NPTIIb
UniProtKB ID: O95436, A5PL17, Q8N2K2, Q8WYA9, Q9P0V7
Gene ID:
Human(10568) Summary: The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(20531) solute carrier family 34 (sodium phosphate), member 2
Rat(84395) solute carrier family 34 (type II sodium/phosphate contransporter), member 2
chicken(395131) solute carrier family 34 (sodium phosphate), member 2
dog(488850) solute carrier family 34 (sodium phosphate), member 2
domestic cat(101101216) solute carrier family 34 (sodium phosphate), member 2
cow(282484) solute carrier family 34 (sodium phosphate), member 2
sheep(101106170) solute carrier family 34 (sodium phosphate), member 2
domestic guinea pig(100717359) solute carrier family 34 (sodium phosphate), member 2
naked mole-rat(101698598) solute carrier family 34 (sodium phosphate), member 2
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121661 MISSION® esiRNA esiRNA human SLC34A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006424 Rosetta Predictions human pricing
NM_053380 Rosetta Predictions rat pricing
XM_579555 Rosetta Predictions rat pricing
NM_011402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213027 predicted 996
2 SASI_Hs01_00213028 predicted 1127
3 SASI_Hs01_00213029 predicted 1422
4 SASI_Hs01_00213030 predicted 924
5 SASI_Hs01_00213031 predicted 971
6 SASI_Hs01_00213032 predicted 640
7 SASI_Hs01_00213033 predicted 701
8 SASI_Hs01_00213034 predicted 1505
9 SASI_Hs02_00341543 predicted 661
10 SASI_Hs01_00213035 predicted 1637
11 SASI_Hs01_00213036 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032024 predicted 812
2 SASI_Rn02_00265865 predicted 2208
3 SASI_Rn01_00032025 predicted 874
4 SASI_Rn01_00032027 predicted 1215
5 SASI_Rn01_00032029 predicted 1486
6 SASI_Rn02_00265866 predicted 1586
7 SASI_Rn02_00265867 predicted 771
8 SASI_Rn02_00265868 predicted 446
9 SASI_Rn02_00265869 predicted 440
10 SASI_Rn02_00265870 predicted 919
11 SASI_Rn01_00032026 predicted 657
12 SASI_Rn01_00032028 predicted 1814
13 SASI_Rn01_00032030 predicted 2152
14 SASI_Rn01_00032031 predicted 1821
15 SASI_Rn01_00032032 predicted 2105
16 SASI_Rn01_00032033 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179514 predicted 792
2 SASI_Rn01_00179515 predicted 644
3 SASI_Rn01_00179516 predicted 1464
4 SASI_Rn01_00179517 predicted 617
5 SASI_Rn01_00179518 predicted 603
6 SASI_Rn01_00179519 predicted 1562
7 SASI_Rn01_00179520 predicted 1487
8 SASI_Rn01_00179521 predicted 752
9 SASI_Rn01_00179522 predicted 420
10 SASI_Rn01_00179523 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189434 predicted 650
2 SASI_Mm01_00189435 predicted 1980
3 SASI_Mm01_00189436 predicted 1102
4 SASI_Mm01_00189437 predicted 864
5 SASI_Mm01_00189438 predicted 1599
6 SASI_Mm01_00189439 predicted 1207
7 SASI_Mm01_00189440 predicted 1570
8 SASI_Mm01_00189441 predicted 1365
9 SASI_Mm01_00189442 predicted 628
10 SASI_Mm01_00189443 predicted 1495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006424
SLC34A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 34 (type II sodium/phosphate contransporter), member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-786s1c1
Sequence:CCGGCGAGATCATAACCCAGCTTATCTCGAGATAAGCTGGGTTATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-193s1c1
Sequence:CCGGCCTGTAACCAAGATTGAACTTCTCGAGAAGTTCAATCTTGGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-2047s1c1
Sequence:CCGGCCTGAGACCTTTGATAACATACTCGAGTATGTTATCAAAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-401s1c1
Sequence:CCGGGCTCCCTGGATATTCTTAGTACTCGAGTACTAAGAATATCCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-1113s1c1
Sequence:CCGGCCAGCATATCTTTGTGAATTTCTCGAGAAATTCACAAAGATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-901s21c1
Sequence:CCGGCTCATTGTCCAGCTGGATAAACTCGAGTTTATCCAGCTGGACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-643s21c1
Sequence:CCGGGCCAACATTGGAACGTCAATCCTCGAGGATTGACGTTCCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-1637s21c1
Sequence:CCGGGCAACATCTCTGCCAAGTATCCTCGAGGATACTTGGCAGAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-1409s21c1
Sequence:CCGGTGATTGGAATCGGCGTGATAACTCGAGTTATCACGCCGATTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006424
SLC34A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 34 (type II sodium/phosphate contransporter), member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-786s1c1
Sequence:CCGGCGAGATCATAACCCAGCTTATCTCGAGATAAGCTGGGTTATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-193s1c1
Sequence:CCGGCCTGTAACCAAGATTGAACTTCTCGAGAAGTTCAATCTTGGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-2047s1c1
Sequence:CCGGCCTGAGACCTTTGATAACATACTCGAGTATGTTATCAAAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-401s1c1
Sequence:CCGGGCTCCCTGGATATTCTTAGTACTCGAGTACTAAGAATATCCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-1113s1c1
Sequence:CCGGCCAGCATATCTTTGTGAATTTCTCGAGAAATTCACAAAGATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-901s21c1
Sequence:CCGGCTCATTGTCCAGCTGGATAAACTCGAGTTTATCCAGCTGGACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-643s21c1
Sequence:CCGGGCCAACATTGGAACGTCAATCCTCGAGGATTGACGTTCCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-1637s21c1
Sequence:CCGGGCAACATCTCTGCCAAGTATCCTCGAGGATACTTGGCAGAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-1409s21c1
Sequence:CCGGTGATTGGAATCGGCGTGATAACTCGAGTTATCACGCCGATTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006424
SLC34A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 34 (type II sodium/phosphate contransporter), member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-786s1c1
Sequence:CCGGCGAGATCATAACCCAGCTTATCTCGAGATAAGCTGGGTTATGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-193s1c1
Sequence:CCGGCCTGTAACCAAGATTGAACTTCTCGAGAAGTTCAATCTTGGTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-2047s1c1
Sequence:CCGGCCTGAGACCTTTGATAACATACTCGAGTATGTTATCAAAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-401s1c1
Sequence:CCGGGCTCCCTGGATATTCTTAGTACTCGAGTACTAAGAATATCCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006424.1-1113s1c1
Sequence:CCGGCCAGCATATCTTTGTGAATTTCTCGAGAAATTCACAAAGATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-901s21c1
Sequence:CCGGCTCATTGTCCAGCTGGATAAACTCGAGTTTATCCAGCTGGACAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-643s21c1
Sequence:CCGGGCCAACATTGGAACGTCAATCCTCGAGGATTGACGTTCCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-1637s21c1
Sequence:CCGGGCAACATCTCTGCCAAGTATCCTCGAGGATACTTGGCAGAGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006424.2-1409s21c1
Sequence:CCGGTGATTGGAATCGGCGTGATAACTCGAGTTATCACGCCGATTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011402
SLC34A2 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 34 (type II sodium/phosphate contransporter), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-558s1c1
Sequence:CCGGGCTTCTTCATTGCTGACGGTTCTCGAGAACCGTCAGCAATGAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-935s1c1
Sequence:CCGGCCTGATCAAGATCTGGTGTAACTCGAGTTACACCAGATCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-434s1c1
Sequence:CCGGCGGACAGTTCTTCAGCAACAACTCGAGTTGTTGCTGAAGAACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-824s1c1
Sequence:CCGGCCCAGACATTCTGAAAGTCATCTCGAGATGACTTTCAGAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-1628s1c1
Sequence:CCGGCGCAGTCTTCTATCTCATCTTCTCGAGAAGATGAGATAGAAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011402
SLC34A2 MISSION shRNA shRNA Plasmid DNA
solute carrier family 34 (type II sodium/phosphate contransporter), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-558s1c1
Sequence:CCGGGCTTCTTCATTGCTGACGGTTCTCGAGAACCGTCAGCAATGAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-935s1c1
Sequence:CCGGCCTGATCAAGATCTGGTGTAACTCGAGTTACACCAGATCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-434s1c1
Sequence:CCGGCGGACAGTTCTTCAGCAACAACTCGAGTTGTTGCTGAAGAACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-824s1c1
Sequence:CCGGCCCAGACATTCTGAAAGTCATCTCGAGATGACTTTCAGAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-1628s1c1
Sequence:CCGGCGCAGTCTTCTATCTCATCTTCTCGAGAAGATGAGATAGAAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011402
SLC34A2 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 34 (type II sodium/phosphate contransporter), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-558s1c1
Sequence:CCGGGCTTCTTCATTGCTGACGGTTCTCGAGAACCGTCAGCAATGAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-935s1c1
Sequence:CCGGCCTGATCAAGATCTGGTGTAACTCGAGTTACACCAGATCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-434s1c1
Sequence:CCGGCGGACAGTTCTTCAGCAACAACTCGAGTTGTTGCTGAAGAACTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-824s1c1
Sequence:CCGGCCCAGACATTCTGAAAGTCATCTCGAGATGACTTTCAGAATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011402.1-1628s1c1
Sequence:CCGGCGCAGTCTTCTATCTCATCTTCTCGAGAAGATGAGATAGAAGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks