EMAIL THIS PAGE TO A FRIEND

SLC34A3

solute carrier family 34 (type II sodium/phosphate contransporter), member 3

Synonyms: HHRH NPTIIc
UniProtKB ID: Q8N130, A2BFA1
Gene ID:
Human(142680) Summary: This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
Mouse(142681) solute carrier family 34 (sodium phosphate), member 3
Rat(246234) solute carrier family 34 (type II sodium/phosphate contransporter), member 3
dog(491232) solute carrier family 34 (sodium phosphate), member 3
domestic cat(101084067) solute carrier family 34 (sodium phosphate), member 3
naked mole-rat(101713460) solute carrier family 34 (sodium phosphate), member 3
domestic guinea pig(100714588) solute carrier family 34 (sodium phosphate), member 3
cow(100299927) solute carrier family 34 (sodium phosphate), member 3
sheep(101109348) solute carrier family 34 (sodium phosphate), member 3
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072141 MISSION® esiRNA esiRNA human SLC34A3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080877 Rosetta Predictions human pricing
NM_139338 Rosetta Predictions rat pricing
NM_080854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230442 predicted 722
2 SASI_Hs01_00230443 predicted 891
3 SASI_Hs01_00230444 predicted 981
4 SASI_Hs01_00230445 predicted 1253
5 SASI_Hs01_00230446 predicted 1521
6 SASI_Hs01_00230447 predicted 486
7 SASI_Hs01_00230448 predicted 767
8 SASI_Hs01_00230449 predicted 217
9 SASI_Hs02_00362674 predicted 937
10 SASI_Hs02_00362675 predicted 920
11 SASI_Hs01_00230450 predicted 609
12 SASI_Hs01_00230451 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093919 predicted 853
2 SASI_Rn02_00268599 predicted 388
3 SASI_Rn01_00093920 predicted 1244
4 SASI_Rn01_00093921 predicted 882
5 SASI_Rn01_00093922 predicted 496
6 SASI_Rn01_00093923 predicted 1533
7 SASI_Rn01_00093924 predicted 836
8 SASI_Rn01_00093925 predicted 551
9 SASI_Rn02_00268600 predicted 1165
10 SASI_Rn01_00093928 predicted 1398
11 SASI_Rn01_00093926 predicted 1562
12 SASI_Rn01_00093927 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073298 predicted 1030
2 SASI_Mm01_00073299 predicted 1538
3 SASI_Mm01_00073300 predicted 1535
4 SASI_Mm01_00073301 predicted 867
5 SASI_Mm02_00338228 predicted 1410
6 SASI_Mm01_00073302 predicted 851
7 SASI_Mm01_00073303 predicted 505
8 SASI_Mm01_00073304 predicted 1404
9 SASI_Mm01_00073305 predicted 537
10 SASI_Mm01_00073306 predicted 876
11 SASI_Mm01_00073307 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080877
SLC34A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 34 (type II sodium/phosphate contransporter), member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080877.2-1764s21c1
Sequence:CCGGCCTCGTCATCCTGGTTACTGTCTCGAGACAGTAACCAGGATGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080877.2-943s21c1
Sequence:CCGGTTGGACTCCGACATGATCATGCTCGAGCATGATCATGTCGGAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-982s1c1
Sequence:CCGGGCCACTAACAGCAGTCTCATTCTCGAGAATGAGACTGCTGTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-501s1c1
Sequence:CCGGCGGAGACATCTTCAAGGACAACTCGAGTTGTCCTTGAAGATGTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-232s1c1
Sequence:CCGGGACGCGGTTGACCTAGTGGAACTCGAGTTCCACTAGGTCAACCGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-1263s1c1
Sequence:CCGGGACAGTCATCAATGCGGACTTCTCGAGAAGTCCGCATTGATGACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-1947s1c1
Sequence:CCGGCTACGAGAACCCTGAGATCTTCTCGAGAAGATCTCAGGGTTCTCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080877
SLC34A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 34 (type II sodium/phosphate contransporter), member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080877.2-1764s21c1
Sequence:CCGGCCTCGTCATCCTGGTTACTGTCTCGAGACAGTAACCAGGATGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080877.2-943s21c1
Sequence:CCGGTTGGACTCCGACATGATCATGCTCGAGCATGATCATGTCGGAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-982s1c1
Sequence:CCGGGCCACTAACAGCAGTCTCATTCTCGAGAATGAGACTGCTGTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-501s1c1
Sequence:CCGGCGGAGACATCTTCAAGGACAACTCGAGTTGTCCTTGAAGATGTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-232s1c1
Sequence:CCGGGACGCGGTTGACCTAGTGGAACTCGAGTTCCACTAGGTCAACCGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-1263s1c1
Sequence:CCGGGACAGTCATCAATGCGGACTTCTCGAGAAGTCCGCATTGATGACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-1947s1c1
Sequence:CCGGCTACGAGAACCCTGAGATCTTCTCGAGAAGATCTCAGGGTTCTCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080877
SLC34A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 34 (type II sodium/phosphate contransporter), member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080877.2-1764s21c1
Sequence:CCGGCCTCGTCATCCTGGTTACTGTCTCGAGACAGTAACCAGGATGACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080877.2-943s21c1
Sequence:CCGGTTGGACTCCGACATGATCATGCTCGAGCATGATCATGTCGGAGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-982s1c1
Sequence:CCGGGCCACTAACAGCAGTCTCATTCTCGAGAATGAGACTGCTGTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-501s1c1
Sequence:CCGGCGGAGACATCTTCAAGGACAACTCGAGTTGTCCTTGAAGATGTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-232s1c1
Sequence:CCGGGACGCGGTTGACCTAGTGGAACTCGAGTTCCACTAGGTCAACCGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-1263s1c1
Sequence:CCGGGACAGTCATCAATGCGGACTTCTCGAGAAGTCCGCATTGATGACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080877.1-1947s1c1
Sequence:CCGGCTACGAGAACCCTGAGATCTTCTCGAGAAGATCTCAGGGTTCTCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080854
SLC34A3 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 34 (type II sodium/phosphate contransporter), member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-543s1c1
Sequence:CCGGCCTATCATCATGGGCGTCAATCTCGAGATTGACGCCCATGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1542s1c1
Sequence:CCGGGCCATTGTCTACCTACTATTACTCGAGTAATAGTAGGTAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-236s1c1
Sequence:CCGGCCAACTGAAAGAGGTTGGCATCTCGAGATGCCAACCTCTTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1668s1c1
Sequence:CCGGCTGGTTAATGTCCTGCAACAACTCGAGTTGTTGCAGGACATTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1155s1c1
Sequence:CCGGCGGACTGTTATCAATGCAGATCTCGAGATCTGCATTGATAACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080854
SLC34A3 MISSION shRNA shRNA Plasmid DNA
solute carrier family 34 (type II sodium/phosphate contransporter), member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-543s1c1
Sequence:CCGGCCTATCATCATGGGCGTCAATCTCGAGATTGACGCCCATGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1542s1c1
Sequence:CCGGGCCATTGTCTACCTACTATTACTCGAGTAATAGTAGGTAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-236s1c1
Sequence:CCGGCCAACTGAAAGAGGTTGGCATCTCGAGATGCCAACCTCTTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1668s1c1
Sequence:CCGGCTGGTTAATGTCCTGCAACAACTCGAGTTGTTGCAGGACATTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1155s1c1
Sequence:CCGGCGGACTGTTATCAATGCAGATCTCGAGATCTGCATTGATAACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080854
SLC34A3 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 34 (type II sodium/phosphate contransporter), member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-543s1c1
Sequence:CCGGCCTATCATCATGGGCGTCAATCTCGAGATTGACGCCCATGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1542s1c1
Sequence:CCGGGCCATTGTCTACCTACTATTACTCGAGTAATAGTAGGTAGACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-236s1c1
Sequence:CCGGCCAACTGAAAGAGGTTGGCATCTCGAGATGCCAACCTCTTTCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1668s1c1
Sequence:CCGGCTGGTTAATGTCCTGCAACAACTCGAGTTGTTGCAGGACATTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080854.1-1155s1c1
Sequence:CCGGCGGACTGTTATCAATGCAGATCTCGAGATCTGCATTGATAACAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks