EMAIL THIS PAGE TO A FRIEND

SLC35C1

solute carrier family 35 (GDP-fucose transporter), member C1

Synonyms: CDG2C FUCT1
UniProtKB ID: Q96A29, B2RDB2, Q9BV76, Q9NUJ8
Gene ID:
Human(55343) Summary: This gene encodes a GDP-fucose transporter that is found in the Golgi apparatus. Mutations in this gene result in congenital disorder of glycosylation type IIc. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(228368) solute carrier family 35, member C1
Rat(311204) solute carrier family 35 (GDP-fucose transporter), member C1
Zebrafish(494047) solute carrier family 35, member C1
chicken(423203) solute carrier family 35, member C1
dog(403593) solute carrier family 35, member C1
Horse(100050209) solute carrier family 35, member C1
domestic cat(101085747) solute carrier family 35, member C1
naked mole-rat(101707959) solute carrier family 35, member C1
domestic guinea pig(100724079) solute carrier family 35, member C1
cow(540413) solute carrier family 35, member C1
sheep(101112417) solute carrier family 35, member C1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV43989 Anti-SLC35C1 antibody produced in rabbit IgG fraction of antiserum rabbit, pig, guinea pig, mouse, bovine, rat, horse, human
western blot pricing
HPA064001 Anti-SLC35C1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018389 Rosetta Predictions human pricing
NM_001107748 Rosetta Predictions rat pricing
NM_145832 Rosetta Predictions mouse pricing
NM_211358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158933 predicted 639
2 SASI_Hs01_00158934 predicted 1347
3 SASI_Hs01_00158935 predicted 525
4 SASI_Hs01_00158936 predicted 1293
5 SASI_Hs01_00158937 predicted 1486
6 SASI_Hs01_00158938 predicted 1297
7 SASI_Hs01_00158939 predicted 1219
8 SASI_Hs01_00158941 predicted 1461
9 SASI_Hs01_00158942 predicted 392
10 SASI_Hs02_00351881 predicted 1326
11 SASI_Hs01_00158940 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231875 predicted 1996
2 SASI_Rn02_00231876 predicted 1440
3 SASI_Rn02_00231877 predicted 1164
4 SASI_Rn02_00231878 predicted 1717
5 SASI_Rn02_00231879 predicted 2014
6 SASI_Rn02_00231880 predicted 810
7 SASI_Rn02_00231881 predicted 865
8 SASI_Rn02_00231882 predicted 1933
9 SASI_Rn02_00231883 predicted 1017
10 SASI_Rn02_00231884 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065514 predicted 1432
2 SASI_Mm01_00065515 predicted 768
3 SASI_Mm01_00065516 predicted 653
4 SASI_Mm01_00065518 predicted 1256
5 SASI_Mm01_00065519 predicted 804
6 SASI_Mm01_00065520 predicted 794
7 SASI_Mm01_00065521 predicted 1305
8 SASI_Mm01_00065522 predicted 415
9 SASI_Mm01_00065523 predicted 481
10 SASI_Mm02_00341299 predicted 726
11 SASI_Mm01_00065517 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_211358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145285 predicted 1928
2 SASI_Mm01_00145286 predicted 1256
3 SASI_Mm01_00145287 predicted 1150
4 SASI_Mm01_00145289 predicted 1743
5 SASI_Mm01_00145290 predicted 1290
6 SASI_Mm01_00145291 predicted 1279
7 SASI_Mm01_00145292 predicted 1788
8 SASI_Mm01_00145293 predicted 906
9 SASI_Mm01_00145294 predicted 961
10 SASI_Mm02_00352253 predicted 1217
11 SASI_Mm01_00145288 predicted 1778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145832
VALIDATED
SLC35C1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 35 (GDP-fucose transporter), member C1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-627s21c1
Sequence:CCGGCGGCGTCATCATTGGTGGTTTCTCGAGAAACCACCAATGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-790s21c1
Sequence:CCGGCGCCTAACCTTCTATAACAATCTCGAGATTGTTATAGAAGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-480s21c1
Sequence:CCGGCGGCATGATAACCTTCAATAACTCGAGTTATTGAAGGTTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-588s21c1
Sequence:CCGGGCTCAAACAGACCACTTCCTTCTCGAGAAGGAAGTGGTCTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-1038s21c1
Sequence:CCGGCGTGCTCTACTACGAAGAGATCTCGAGATCTCTTCGTAGTAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145832.2-480s1c1
Sequence:CCGGCGGCATGATAACCTTCAATAACTCGAGTTATTGAAGGTTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-790s1c1
Sequence:CCGGCGCCTAACCTTCTATAACAATCTCGAGATTGTTATAGAAGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-1038s1c1
Sequence:CCGGCGTGCTCTACTACGAAGAGATCTCGAGATCTCTTCGTAGTAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-627s1c1
Sequence:CCGGCGGCGTCATCATTGGTGGTTTCTCGAGAAACCACCAATGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145832.2-588s1c1
Sequence:CCGGGCTCAAACAGACCACTTCCTTCTCGAGAAGGAAGTGGTCTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145832
VALIDATED
SLC35C1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 35 (GDP-fucose transporter), member C1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-627s21c1
Sequence:CCGGCGGCGTCATCATTGGTGGTTTCTCGAGAAACCACCAATGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-790s21c1
Sequence:CCGGCGCCTAACCTTCTATAACAATCTCGAGATTGTTATAGAAGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-480s21c1
Sequence:CCGGCGGCATGATAACCTTCAATAACTCGAGTTATTGAAGGTTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-588s21c1
Sequence:CCGGGCTCAAACAGACCACTTCCTTCTCGAGAAGGAAGTGGTCTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-1038s21c1
Sequence:CCGGCGTGCTCTACTACGAAGAGATCTCGAGATCTCTTCGTAGTAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145832.2-480s1c1
Sequence:CCGGCGGCATGATAACCTTCAATAACTCGAGTTATTGAAGGTTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-790s1c1
Sequence:CCGGCGCCTAACCTTCTATAACAATCTCGAGATTGTTATAGAAGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-1038s1c1
Sequence:CCGGCGTGCTCTACTACGAAGAGATCTCGAGATCTCTTCGTAGTAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-627s1c1
Sequence:CCGGCGGCGTCATCATTGGTGGTTTCTCGAGAAACCACCAATGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145832.2-588s1c1
Sequence:CCGGGCTCAAACAGACCACTTCCTTCTCGAGAAGGAAGTGGTCTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145832
VALIDATED
SLC35C1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 35 (GDP-fucose transporter), member C1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-627s21c1
Sequence:CCGGCGGCGTCATCATTGGTGGTTTCTCGAGAAACCACCAATGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-790s21c1
Sequence:CCGGCGCCTAACCTTCTATAACAATCTCGAGATTGTTATAGAAGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-480s21c1
Sequence:CCGGCGGCATGATAACCTTCAATAACTCGAGTTATTGAAGGTTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-588s21c1
Sequence:CCGGGCTCAAACAGACCACTTCCTTCTCGAGAAGGAAGTGGTCTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145832.3-1038s21c1
Sequence:CCGGCGTGCTCTACTACGAAGAGATCTCGAGATCTCTTCGTAGTAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145832.2-480s1c1
Sequence:CCGGCGGCATGATAACCTTCAATAACTCGAGTTATTGAAGGTTATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-790s1c1
Sequence:CCGGCGCCTAACCTTCTATAACAATCTCGAGATTGTTATAGAAGGTTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-1038s1c1
Sequence:CCGGCGTGCTCTACTACGAAGAGATCTCGAGATCTCTTCGTAGTAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145832.2-627s1c1
Sequence:CCGGCGGCGTCATCATTGGTGGTTTCTCGAGAAACCACCAATGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145832.2-588s1c1
Sequence:CCGGGCTCAAACAGACCACTTCCTTCTCGAGAAGGAAGTGGTCTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018389
VALIDATED
SLC35C1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 35 (GDP-fucose transporter), member C1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018389.3-1339s1c1
Sequence:CCGGCCCTTCTCTATCCTCTCGTATCTCGAGATACGAGAGGATAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018389.3-392s1c1
Sequence:CCGGCGGCATGATCACCTTCAATAACTCGAGTTATTGAAGGTGATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018389.3-980s1c1
Sequence:CCGGCCTCTGGTGGACGAGCAACATCTCGAGATGTTGCTCGTCCACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018389.3-836s1c1
Sequence:CCGGCGGCCTGTTTGGCTTTGCCATCTCGAGATGGCAAAGCCAAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018389.3-704s1c1
Sequence:CCGGCCTGACTTTCTACAACAACGTCTCGAGACGTTGTTGTAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018389
VALIDATED
SLC35C1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 35 (GDP-fucose transporter), member C1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018389.3-1339s1c1
Sequence:CCGGCCCTTCTCTATCCTCTCGTATCTCGAGATACGAGAGGATAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018389.3-392s1c1
Sequence:CCGGCGGCATGATCACCTTCAATAACTCGAGTTATTGAAGGTGATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018389.3-980s1c1
Sequence:CCGGCCTCTGGTGGACGAGCAACATCTCGAGATGTTGCTCGTCCACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018389.3-836s1c1
Sequence:CCGGCGGCCTGTTTGGCTTTGCCATCTCGAGATGGCAAAGCCAAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018389.3-704s1c1
Sequence:CCGGCCTGACTTTCTACAACAACGTCTCGAGACGTTGTTGTAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018389
VALIDATED
SLC35C1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 35 (GDP-fucose transporter), member C1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018389.3-1339s1c1
Sequence:CCGGCCCTTCTCTATCCTCTCGTATCTCGAGATACGAGAGGATAGAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018389.3-392s1c1
Sequence:CCGGCGGCATGATCACCTTCAATAACTCGAGTTATTGAAGGTGATCATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018389.3-980s1c1
Sequence:CCGGCCTCTGGTGGACGAGCAACATCTCGAGATGTTGCTCGTCCACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018389.3-836s1c1
Sequence:CCGGCGGCCTGTTTGGCTTTGCCATCTCGAGATGGCAAAGCCAAACAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018389.3-704s1c1
Sequence:CCGGCCTGACTTTCTACAACAACGTCTCGAGACGTTGTTGTAGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks