EMAIL THIS PAGE TO A FRIEND

SLC38A11

solute carrier family 38, member 11

Synonyms: AVT2
UniProtKB ID: Q08AI6, B4DF99, Q8N887
Gene ID:
Mouse(320106) solute carrier family 38, member 11
Rat(362141) solute carrier family 38, member 11
Zebrafish(550337) solute carrier family 38, member 11
domestic cat(101100240) solute carrier family 38, member 11
dog(488377) solute carrier family 38, member 11
chicken(424181) solute carrier family 38, member 11
cow(523418) solute carrier family 38, member 11
sheep(101104635) solute carrier family 38, member 11
domestic guinea pig(100717785) solute carrier family 38, member 11
naked mole-rat(101716418) solute carrier family 38, member 11
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173512 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030841 MISSION® esiRNA esiRNA human SLC38A11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173512 Rosetta Predictions human pricing
XM_001055605 Rosetta Predictions rat pricing
XM_001055669 Rosetta Predictions rat pricing
XM_342441 Rosetta Predictions rat pricing
NM_177074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030069 predicted 594
2 SASI_Hs01_00030070 predicted 1152
3 SASI_Hs01_00030071 predicted 1113
4 SASI_Hs01_00030072 predicted 535
5 SASI_Hs01_00030074 predicted 856
6 SASI_Hs02_00368286 predicted 565
7 SASI_Hs01_00030075 predicted 587
8 SASI_Hs02_00368287 predicted 984
9 SASI_Hs01_00030078 predicted 803
10 SASI_Hs02_00368288 predicted 899
11 SASI_Hs01_00030073 predicted 795
12 SASI_Hs01_00030076 predicted 1228
13 SASI_Hs01_00030077 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280272 predicted 433
2 SASI_Rn02_00280273 predicted 565
3 SASI_Rn02_00280274 predicted 381
4 SASI_Rn02_00280275 predicted 660
5 SASI_Rn02_00280276 predicted 933
6 SASI_Rn02_00280277 predicted 464
7 SASI_Rn02_00280278 predicted 568
8 SASI_Rn02_00280279 predicted 950
9 SASI_Rn02_00280280 predicted 397
10 SASI_Rn02_00280281 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280571 predicted 486
2 SASI_Rn02_00280572 predicted 609
3 SASI_Rn02_00280573 predicted 259
4 SASI_Rn02_00280574 predicted 731
5 SASI_Rn02_00280575 predicted 550
6 SASI_Rn02_00280576 predicted 1107
7 SASI_Rn02_00280577 predicted 638
8 SASI_Rn02_00280578 predicted 262
9 SASI_Rn02_00280579 predicted 1122
10 SASI_Rn02_00280580 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394269 predicted 1279
2 SASI_Rn02_00394270 predicted 996
3 SASI_Rn02_00394271 predicted 957
4 SASI_Rn02_00394272 predicted 1176
5 SASI_Rn02_00394273 predicted 1106
6 SASI_Rn02_00394274 predicted 1074
7 SASI_Rn02_00394275 predicted 1281
8 SASI_Rn02_00394276 predicted 1050
9 SASI_Rn02_00394277 predicted 1248
10 SASI_Rn02_00394278 predicted 1128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347044 predicted 476
2 SASI_Mm02_00347045 predicted 673
3 SASI_Mm02_00347046 predicted 603
4 SASI_Mm02_00347047 predicted 487
5 SASI_Mm02_00347048 predicted 457
6 SASI_Mm02_00347049 predicted 250
7 SASI_Mm02_00347050 predicted 873
8 SASI_Mm02_00347051 predicted 735
9 SASI_Mm02_00347052 predicted 1053
10 SASI_Mm02_00347053 predicted 871
11 SASI_Mm01_00025849 predicted 771
12 SASI_Mm01_00025850 predicted 413
13 SASI_Mm01_00025851 predicted 488
14 SASI_Mm01_00025852 predicted 629
15 SASI_Mm01_00025853 predicted 397
16 SASI_Mm01_00025854 predicted 355
17 SASI_Mm01_00025855 predicted 586
18 SASI_Mm01_00025856 predicted 519
19 SASI_Mm01_00025857 predicted 447
20 SASI_Mm01_00025858 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177074
SLC38A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 38, member 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177074.1-588s1c1
Sequence:CCGGGCAATGTGTATGTATCACAAACTCGAGTTTGTGATACATACACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-142s1c1
Sequence:CCGGCTGTTATAGGATCTGGGATAACTCGAGTTATCCCAGATCCTATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-85s1c1
Sequence:CCGGGACATGAACACGGAGGGAAATCTCGAGATTTCCCTCCGTGTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-390s1c1
Sequence:CCGGGCCACCAAAGAACATTTAGTTCTCGAGAACTAAATGTTCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-349s1c1
Sequence:CCGGCCCTACAGTTTATGTACCCTTCTCGAGAAGGGTACATAAACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177074.2-1282s21c1
Sequence:CCGGGGACACATTCCGATAAGATAACTCGAGTTATCTTATCGGAATGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177074.2-1063s21c1
Sequence:CCGGTTGTGACCAGAGAGGTAATTGCTCGAGCAATTACCTCTCTGGTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177074
SLC38A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 38, member 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177074.1-588s1c1
Sequence:CCGGGCAATGTGTATGTATCACAAACTCGAGTTTGTGATACATACACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-142s1c1
Sequence:CCGGCTGTTATAGGATCTGGGATAACTCGAGTTATCCCAGATCCTATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-85s1c1
Sequence:CCGGGACATGAACACGGAGGGAAATCTCGAGATTTCCCTCCGTGTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-390s1c1
Sequence:CCGGGCCACCAAAGAACATTTAGTTCTCGAGAACTAAATGTTCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-349s1c1
Sequence:CCGGCCCTACAGTTTATGTACCCTTCTCGAGAAGGGTACATAAACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177074.2-1282s21c1
Sequence:CCGGGGACACATTCCGATAAGATAACTCGAGTTATCTTATCGGAATGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177074.2-1063s21c1
Sequence:CCGGTTGTGACCAGAGAGGTAATTGCTCGAGCAATTACCTCTCTGGTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177074
SLC38A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 38, member 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102010    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177074.1-588s1c1
Sequence:CCGGGCAATGTGTATGTATCACAAACTCGAGTTTGTGATACATACACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-142s1c1
Sequence:CCGGCTGTTATAGGATCTGGGATAACTCGAGTTATCCCAGATCCTATAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-85s1c1
Sequence:CCGGGACATGAACACGGAGGGAAATCTCGAGATTTCCCTCCGTGTTCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-390s1c1
Sequence:CCGGGCCACCAAAGAACATTTAGTTCTCGAGAACTAAATGTTCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177074.1-349s1c1
Sequence:CCGGCCCTACAGTTTATGTACCCTTCTCGAGAAGGGTACATAAACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177074.2-1282s21c1
Sequence:CCGGGGACACATTCCGATAAGATAACTCGAGTTATCTTATCGGAATGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177074.2-1063s21c1
Sequence:CCGGTTGTGACCAGAGAGGTAATTGCTCGAGCAATTACCTCTCTGGTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173512
SLC38A11 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 38, member 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-743s1c1
Sequence:CCGGGCAAAGCCCAATGCCATTCAACTCGAGTTGAATGGCATTGGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-1157s1c1
Sequence:CCGGCTGATTGATTGCCTCGGGATACTCGAGTATCCCGAGGCAATCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-579s1c1
Sequence:CCGGCAGTTACCTTTACTCTGCCTTCTCGAGAAGGCAGAGTAAAGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-435s1c1
Sequence:CCGGGAACAGATACCTACCAGTCTTCTCGAGAAGACTGGTAGGTATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173512.1-1376s1c1
Sequence:CCGGCAGGAAATGTTCTACTGCTTTCTCGAGAAAGCAGTAGAACATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-1083s1c1
Sequence:CCGGGTGGGAATCTTTCATCGGTTTCTCGAGAAACCGATGAAAGATTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173512.1-969s1c1
Sequence:CCGGGCAGAAATGATGACCTGGTAACTCGAGTTACCAGGTCATCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173512.1-844s21c1
Sequence:CCGGAGCTAAGTGGTCCCGCCTTATCTCGAGATAAGGCGGGACCACTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173512.1-1266s21c1
Sequence:CCGGGGACACACTCCGATAAGATTACTCGAGTAATCTTATCGGAGTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173512
SLC38A11 MISSION shRNA shRNA Plasmid DNA
solute carrier family 38, member 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-743s1c1
Sequence:CCGGGCAAAGCCCAATGCCATTCAACTCGAGTTGAATGGCATTGGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-1157s1c1
Sequence:CCGGCTGATTGATTGCCTCGGGATACTCGAGTATCCCGAGGCAATCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-579s1c1
Sequence:CCGGCAGTTACCTTTACTCTGCCTTCTCGAGAAGGCAGAGTAAAGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-435s1c1
Sequence:CCGGGAACAGATACCTACCAGTCTTCTCGAGAAGACTGGTAGGTATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173512.1-1376s1c1
Sequence:CCGGCAGGAAATGTTCTACTGCTTTCTCGAGAAAGCAGTAGAACATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-1083s1c1
Sequence:CCGGGTGGGAATCTTTCATCGGTTTCTCGAGAAACCGATGAAAGATTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173512.1-969s1c1
Sequence:CCGGGCAGAAATGATGACCTGGTAACTCGAGTTACCAGGTCATCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173512.1-844s21c1
Sequence:CCGGAGCTAAGTGGTCCCGCCTTATCTCGAGATAAGGCGGGACCACTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173512.1-1266s21c1
Sequence:CCGGGGACACACTCCGATAAGATTACTCGAGTAATCTTATCGGAGTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173512
SLC38A11 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 38, member 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-743s1c1
Sequence:CCGGGCAAAGCCCAATGCCATTCAACTCGAGTTGAATGGCATTGGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-1157s1c1
Sequence:CCGGCTGATTGATTGCCTCGGGATACTCGAGTATCCCGAGGCAATCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-579s1c1
Sequence:CCGGCAGTTACCTTTACTCTGCCTTCTCGAGAAGGCAGAGTAAAGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-435s1c1
Sequence:CCGGGAACAGATACCTACCAGTCTTCTCGAGAAGACTGGTAGGTATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173512.1-1376s1c1
Sequence:CCGGCAGGAAATGTTCTACTGCTTTCTCGAGAAAGCAGTAGAACATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173512.1-1083s1c1
Sequence:CCGGGTGGGAATCTTTCATCGGTTTCTCGAGAAACCGATGAAAGATTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173512.1-969s1c1
Sequence:CCGGGCAGAAATGATGACCTGGTAACTCGAGTTACCAGGTCATCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173512.1-844s21c1
Sequence:CCGGAGCTAAGTGGTCCCGCCTTATCTCGAGATAAGGCGGGACCACTTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173512.1-1266s21c1
Sequence:CCGGGGACACACTCCGATAAGATTACTCGAGTAATCTTATCGGAGTGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks