EMAIL THIS PAGE TO A FRIEND

SLC38A8

solute carrier family 38, member 8

UniProtKB ID: A6NNN8
Gene ID:
Mouse(234788) solute carrier family 38, member 8
Rat(502208) solute carrier family 38, member 8
chicken(100857309) solute carrier family 38, member 8
dog(489685) solute carrier family 38, member 8
Horse(100630306) solute carrier family 38, member 8
domestic cat(101087371) solute carrier family 38, member 8
naked mole-rat(101714702) solute carrier family 38, member 8
domestic guinea pig(100730682) solute carrier family 38, member 8
cow(518625) solute carrier family 38, member 8
sheep(101123487) solute carrier family 38, member 8
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302165 ANTI-SLC38A8 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001009950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080442 Rosetta Predictions human pricing
XM_085347 Rosetta Predictions human pricing
XM_001078590 Rosetta Predictions rat pricing
XM_577668 Rosetta Predictions rat pricing
NM_001009950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314886 predicted 495
2 SASI_Hs02_00314887 predicted 839
3 SASI_Hs02_00314888 predicted 862
4 SASI_Hs02_00314889 predicted 379
5 SASI_Hs02_00314890 predicted 879
6 SASI_Hs02_00314891 predicted 864
7 SASI_Hs02_00314892 predicted 562
8 SASI_Hs02_00314893 predicted 327
9 SASI_Hs02_00314894 predicted 1077
10 SASI_Hs02_00314895 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_085347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258427 predicted 219
2 SASI_Hs01_00258428 predicted 383
3 SASI_Hs01_00258429 predicted 232
4 SASI_Hs01_00258430 predicted 338
5 SASI_Hs01_00258431 predicted 246
6 SASI_Hs01_00258432 predicted 293
7 SASI_Hs01_00258433 predicted 287
8 SASI_Hs01_00258434 predicted 227
9 SASI_Hs01_00258435 predicted 235
10 SASI_Hs01_00258436 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361358 predicted 382
2 SASI_Rn02_00361359 predicted 743
3 SASI_Rn02_00361360 predicted 660
4 SASI_Rn02_00361361 predicted 935
5 SASI_Rn02_00361362 predicted 209
6 SASI_Rn02_00361363 predicted 826
7 SASI_Rn02_00361364 predicted 636
8 SASI_Rn02_00361365 predicted 331
9 SASI_Rn02_00361366 predicted 739
10 SASI_Rn02_00361367 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406885 predicted 382
2 SASI_Rn02_00406886 predicted 745
3 SASI_Rn02_00406887 predicted 665
4 SASI_Rn02_00406888 predicted 935
5 SASI_Rn02_00406889 predicted 214
6 SASI_Rn02_00406890 predicted 827
7 SASI_Rn02_00406891 predicted 642
8 SASI_Rn02_00406892 predicted 327
9 SASI_Rn02_00406893 predicted 732
10 SASI_Rn02_00406894 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082292 predicted 1415
2 SASI_Mm01_00082293 predicted 817
3 SASI_Mm01_00082294 predicted 511
4 SASI_Mm01_00082295 predicted 1009
5 SASI_Mm01_00082297 predicted 1536
6 SASI_Mm01_00082298 predicted 260
7 SASI_Mm01_00082299 predicted 666
8 SASI_Mm01_00082300 predicted 669
9 SASI_Mm01_00082301 predicted 623
10 SASI_Mm02_00286890 predicted 731
11 SASI_Mm01_00082296 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080442
SLC38A8 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 38, member 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-904s21c1
Sequence:CCGGTTTGCTGTCTCCATCGTAACTCTCGAGAGTTACGATGGAGACAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-713s21c1
Sequence:CCGGTCTACTGCAGCATGCGCAAACCTCGAGGTTTGCGCATGCTGCAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-858s21c1
Sequence:CCGGGTCCTACCCAGGCAATGATATCTCGAGATATCATTGCCTGGGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-1092s21c1
Sequence:CCGGTATGCCTGACCTCAGCGAGATCTCGAGATCTCGCTGAGGTCAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080442
SLC38A8 MISSION shRNA shRNA Plasmid DNA
solute carrier family 38, member 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-904s21c1
Sequence:CCGGTTTGCTGTCTCCATCGTAACTCTCGAGAGTTACGATGGAGACAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-713s21c1
Sequence:CCGGTCTACTGCAGCATGCGCAAACCTCGAGGTTTGCGCATGCTGCAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-858s21c1
Sequence:CCGGGTCCTACCCAGGCAATGATATCTCGAGATATCATTGCCTGGGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-1092s21c1
Sequence:CCGGTATGCCTGACCTCAGCGAGATCTCGAGATCTCGCTGAGGTCAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080442
SLC38A8 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 38, member 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-904s21c1
Sequence:CCGGTTTGCTGTCTCCATCGTAACTCTCGAGAGTTACGATGGAGACAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-713s21c1
Sequence:CCGGTCTACTGCAGCATGCGCAAACCTCGAGGTTTGCGCATGCTGCAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-858s21c1
Sequence:CCGGGTCCTACCCAGGCAATGATATCTCGAGATATCATTGCCTGGGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080442.1-1092s21c1
Sequence:CCGGTATGCCTGACCTCAGCGAGATCTCGAGATCTCGCTGAGGTCAGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009950
SLC38A8 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 38, member 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009950.1-2040s1c1
Sequence:CCGGGCTGAGCCATTACATTCTCATCTCGAGATGAGAATGTAATGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-1269s1c1
Sequence:CCGGCCTCAGCGAGATCATTAGCATCTCGAGATGCTAATGATCTCGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-732s1c1
Sequence:CCGGTCTGGTCATCACGGTGCAATACTCGAGTATTGCACCGTGATGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-1286s1c1
Sequence:CCGGGCATCATTGGTGGTGTCAGTTCTCGAGAACTGACACCACCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-813s1c1
Sequence:CCGGGACCTCTGTGTTTAGCGTGTTCTCGAGAACACGCTAAACACAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009950
SLC38A8 MISSION shRNA shRNA Plasmid DNA
solute carrier family 38, member 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009950.1-2040s1c1
Sequence:CCGGGCTGAGCCATTACATTCTCATCTCGAGATGAGAATGTAATGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-1269s1c1
Sequence:CCGGCCTCAGCGAGATCATTAGCATCTCGAGATGCTAATGATCTCGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-732s1c1
Sequence:CCGGTCTGGTCATCACGGTGCAATACTCGAGTATTGCACCGTGATGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-1286s1c1
Sequence:CCGGGCATCATTGGTGGTGTCAGTTCTCGAGAACTGACACCACCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-813s1c1
Sequence:CCGGGACCTCTGTGTTTAGCGTGTTCTCGAGAACACGCTAAACACAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009950
SLC38A8 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 38, member 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001009950.1-2040s1c1
Sequence:CCGGGCTGAGCCATTACATTCTCATCTCGAGATGAGAATGTAATGGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-1269s1c1
Sequence:CCGGCCTCAGCGAGATCATTAGCATCTCGAGATGCTAATGATCTCGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-732s1c1
Sequence:CCGGTCTGGTCATCACGGTGCAATACTCGAGTATTGCACCGTGATGACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-1286s1c1
Sequence:CCGGGCATCATTGGTGGTGTCAGTTCTCGAGAACTGACACCACCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009950.1-813s1c1
Sequence:CCGGGACCTCTGTGTTTAGCGTGTTCTCGAGAACACGCTAAACACAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks