EMAIL THIS PAGE TO A FRIEND

SLC39A12

solute carrier family 39 (zinc transporter), member 12

Synonyms: LZT-Hs8 ZIP-12 bA570F3.1
Gene ID:
Human(221074) Summary: Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]
Mouse(277468) solute carrier family 39 (zinc transporter), member 12
Rat(291328) solute carrier family 39 (zinc transporter), member 12
cow(527210) solute carrier family 39 (zinc transporter), member 12
sheep(101111648) solute carrier family 39 (zinc transporter), member 12
domestic guinea pig(100719835) solute carrier family 39 (zinc transporter), member 12
naked mole-rat(101716204) solute carrier family 39 (zinc transporter), member 12
Domestic Rabbit(100346557) solute carrier family 39 (zinc transporter), member 12
chicken(420514) solute carrier family 39 (zinc transporter), member 12
dog(477989) solute carrier family 39 (zinc transporter), member 12
Horse(100056009) solute carrier family 39 (zinc transporter), member 12
domestic cat(101092444) solute carrier family 39 (zinc transporter), member 12
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44127 Anti-SLC39A12 antibody produced in rabbit affinity isolated antibody horse, human, bovine
western blot pricing
SAB3500601 Anti-ZIP12 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_205887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_205887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_205887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020071 MISSION® esiRNA esiRNA human SLC39A12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152725 Rosetta Predictions human pricing
NM_001106124 Rosetta Predictions rat pricing
NM_001012305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080345 predicted 615
2 SASI_Hs01_00080346 predicted 1069
3 SASI_Hs01_00080347 predicted 1214
4 SASI_Hs01_00080348 predicted 905
5 SASI_Hs01_00080350 predicted 324
6 SASI_Hs01_00080351 predicted 708
7 SASI_Hs01_00080352 predicted 2064
8 SASI_Hs01_00080353 predicted 1528
9 SASI_Hs01_00080354 predicted 1257
10 SASI_Hs02_00366631 predicted 235
11 SASI_Hs01_00080349 predicted 1937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215858 predicted 1056
2 SASI_Rn02_00215859 predicted 1462
3 SASI_Rn02_00215860 predicted 1045
4 SASI_Rn02_00215861 predicted 1850
5 SASI_Rn02_00215862 predicted 912
6 SASI_Rn02_00215863 predicted 1780
7 SASI_Rn02_00215864 predicted 1764
8 SASI_Rn02_00215865 predicted 1670
9 SASI_Rn02_00215866 predicted 1532
10 SASI_Rn02_00215867 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059886 predicted 709
2 SASI_Mm01_00059887 predicted 1798
3 SASI_Mm01_00059888 predicted 1487
4 SASI_Mm01_00059889 predicted 1893
5 SASI_Mm01_00059890 predicted 960
6 SASI_Mm01_00059891 predicted 1659
7 SASI_Mm01_00059892 predicted 2206
8 SASI_Mm01_00059893 predicted 2284
9 SASI_Mm01_00059895 predicted 1879
10 SASI_Mm02_00287075 predicted 1629
11 SASI_Mm01_00059894 predicted 2319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152725
SLC39A12 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39 (zinc transporter), member 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-543s21c1
Sequence:CCGGACCAGATGCACTATTACTAATCTCGAGATTAGTAATAGTGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-1589s21c1
Sequence:CCGGATGAAAGCAAAGGTCATATTTCTCGAGAAATATGACCTTTGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-2196s21c1
Sequence:CCGGTCTCCTGCTCTTGGCTATATACTCGAGTATATAGCCAAGAGCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-908s1c1
Sequence:CCGGCCCAGACTACTTTACAGAATACTCGAGTATTCTGTAAAGTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-963s1c1
Sequence:CCGGCGCCTATCAGAACTAGACCAACTCGAGTTGGTCTAGTTCTGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-398s1c1
Sequence:CCGGCCACTCAAGAAGCCTCATCAACTCGAGTTGATGAGGCTTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-1485s1c1
Sequence:CCGGCCTCAGGTTCTTGGTTTACATCTCGAGATGTAAACCAAGAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-2022s1c1
Sequence:CCGGGCTGGGATGTTCTTATATTTACTCGAGTAAATATAAGAACATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152725
SLC39A12 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39 (zinc transporter), member 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-543s21c1
Sequence:CCGGACCAGATGCACTATTACTAATCTCGAGATTAGTAATAGTGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-1589s21c1
Sequence:CCGGATGAAAGCAAAGGTCATATTTCTCGAGAAATATGACCTTTGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-2196s21c1
Sequence:CCGGTCTCCTGCTCTTGGCTATATACTCGAGTATATAGCCAAGAGCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-908s1c1
Sequence:CCGGCCCAGACTACTTTACAGAATACTCGAGTATTCTGTAAAGTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-963s1c1
Sequence:CCGGCGCCTATCAGAACTAGACCAACTCGAGTTGGTCTAGTTCTGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-398s1c1
Sequence:CCGGCCACTCAAGAAGCCTCATCAACTCGAGTTGATGAGGCTTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-1485s1c1
Sequence:CCGGCCTCAGGTTCTTGGTTTACATCTCGAGATGTAAACCAAGAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-2022s1c1
Sequence:CCGGGCTGGGATGTTCTTATATTTACTCGAGTAAATATAAGAACATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152725
SLC39A12 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39 (zinc transporter), member 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-543s21c1
Sequence:CCGGACCAGATGCACTATTACTAATCTCGAGATTAGTAATAGTGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-1589s21c1
Sequence:CCGGATGAAAGCAAAGGTCATATTTCTCGAGAAATATGACCTTTGCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152725.3-2196s21c1
Sequence:CCGGTCTCCTGCTCTTGGCTATATACTCGAGTATATAGCCAAGAGCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-908s1c1
Sequence:CCGGCCCAGACTACTTTACAGAATACTCGAGTATTCTGTAAAGTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-963s1c1
Sequence:CCGGCGCCTATCAGAACTAGACCAACTCGAGTTGGTCTAGTTCTGATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-398s1c1
Sequence:CCGGCCACTCAAGAAGCCTCATCAACTCGAGTTGATGAGGCTTCTTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-1485s1c1
Sequence:CCGGCCTCAGGTTCTTGGTTTACATCTCGAGATGTAAACCAAGAACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152725.1-2022s1c1
Sequence:CCGGGCTGGGATGTTCTTATATTTACTCGAGTAAATATAAGAACATCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_205887
SLC39A12 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39 (zinc transporter), member 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-1918s1c1
Sequence:CCGGCCACATGAAATGGGAGACTTTCTCGAGAAAGTCTCCCATTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-987s1c1
Sequence:CCGGCCTCCATCAATACCAAAGGAACTCGAGTTCCTTTGGTATTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-1258s1c1
Sequence:CCGGCCCACCACTCTGGAGAAATATCTCGAGATATTTCTCCAGAGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-714s1c1
Sequence:CCGGCCAGTGTATGGAAACTAAGATCTCGAGATCTTAGTTTCCATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-351s1c1
Sequence:CCGGCCATCCACAAAGCCTCATCAACTCGAGTTGATGAGGCTTTGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_205887
SLC39A12 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39 (zinc transporter), member 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-1918s1c1
Sequence:CCGGCCACATGAAATGGGAGACTTTCTCGAGAAAGTCTCCCATTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-987s1c1
Sequence:CCGGCCTCCATCAATACCAAAGGAACTCGAGTTCCTTTGGTATTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-1258s1c1
Sequence:CCGGCCCACCACTCTGGAGAAATATCTCGAGATATTTCTCCAGAGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-714s1c1
Sequence:CCGGCCAGTGTATGGAAACTAAGATCTCGAGATCTTAGTTTCCATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-351s1c1
Sequence:CCGGCCATCCACAAAGCCTCATCAACTCGAGTTGATGAGGCTTTGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_205887
SLC39A12 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39 (zinc transporter), member 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-1918s1c1
Sequence:CCGGCCACATGAAATGGGAGACTTTCTCGAGAAAGTCTCCCATTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-987s1c1
Sequence:CCGGCCTCCATCAATACCAAAGGAACTCGAGTTCCTTTGGTATTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-1258s1c1
Sequence:CCGGCCCACCACTCTGGAGAAATATCTCGAGATATTTCTCCAGAGTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-714s1c1
Sequence:CCGGCCAGTGTATGGAAACTAAGATCTCGAGATCTTAGTTTCCATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_205887.3-351s1c1
Sequence:CCGGCCATCCACAAAGCCTCATCAACTCGAGTTGATGAGGCTTTGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks