EMAIL THIS PAGE TO A FRIEND

SLC39A6

solute carrier family 39 (zinc transporter), member 6

Synonyms: LIV-1
UniProtKB ID: Q13433, B4DR49, B4E224, Q8IXR3, Q96HP5
Gene ID:
Human(25800) Summary: Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A6 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]
Mouse(106957) solute carrier family 39 (metal ion transporter), member 6
Rat(291733) solute carrier family 39 (zinc transporter), member 6
Zebrafish(324303) solute carrier family 39 (zinc transporter), member 6
chicken(420984) solute carrier family 39 (zinc transporter), member 6
dog(480159) solute carrier family 39 (zinc transporter), member 6
domestic cat(101095202) solute carrier family 39 (zinc transporter), member 6
cow(524456) solute carrier family 39 (zinc transporter), member 6
sheep(100302554) solute carrier family 39 (zinc transporter), member 6
naked mole-rat(101712890) solute carrier family 39 (zinc transporter), member 6
domestic guinea pig(100733618) solute carrier family 39 (zinc transporter), member 6
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099406 Rosetta Predictions human pricing
NM_012319 Rosetta Predictions human pricing
NM_001024745 Rosetta Predictions rat pricing
NM_139143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320589 predicted 813
2 SASI_Hs02_00320590 predicted 897
3 SASI_Hs02_00320591 predicted 850
4 SASI_Hs02_00320592 predicted 750
5 SASI_Hs02_00320593 predicted 891
6 SASI_Hs02_00320594 predicted 694
7 SASI_Hs02_00320595 predicted 894
8 SASI_Hs02_00320596 predicted 818
9 SASI_Hs02_00320597 predicted 623
10 SASI_Hs02_00320598 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344095 predicted 1609
2 SASI_Hs02_00344096 predicted 1698
3 SASI_Hs01_00238528 predicted 1640
4 SASI_Hs02_00344097 predicted 1549
5 SASI_Hs02_00344098 predicted 1682
6 SASI_Hs02_00344099 predicted 1494
7 SASI_Hs02_00344100 predicted 1689
8 SASI_Hs02_00344101 predicted 1617
9 SASI_Hs02_00344102 predicted 1424
10 SASI_Hs02_00344103 predicted 1579
11 SASI_Hs01_00238525 predicted 1016
12 SASI_Hs01_00238526 predicted 2080
13 SASI_Hs01_00238527 predicted 1012
14 SASI_Hs01_00238529 predicted 2340
15 SASI_Hs01_00238530 predicted 265
16 SASI_Hs01_00238531 predicted 642
17 SASI_Hs01_00238532 predicted 936
18 SASI_Hs01_00238533 predicted 611
19 SASI_Hs01_00238534 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071056 predicted 1112
2 SASI_Rn01_00071057 predicted 1052
3 SASI_Rn01_00071058 predicted 1479
4 SASI_Rn01_00071059 predicted 698
5 SASI_Rn01_00071060 predicted 2144
6 SASI_Rn01_00071061 predicted 670
7 SASI_Rn01_00071063 predicted 2126
8 SASI_Rn01_00071064 predicted 2413
9 SASI_Rn01_00071065 predicted 2323
10 SASI_Rn02_00202618 predicted 2366
11 SASI_Rn01_00071062 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112819 predicted 2915
2 SASI_Mm01_00112820 predicted 1516
3 SASI_Mm02_00339888 predicted 566
4 SASI_Mm01_00112821 predicted 2568
5 SASI_Mm01_00112822 predicted 1497
6 SASI_Mm01_00112823 predicted 2588
7 SASI_Mm02_00339889 predicted 680
8 SASI_Mm01_00112825 predicted 2687
9 SASI_Mm01_00112826 predicted 1889
10 SASI_Mm02_00339890 predicted 1140
11 SASI_Mm01_00112824 predicted 1982
12 SASI_Mm01_00112827 predicted 891
13 SASI_Mm01_00112828 predicted 1976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139143
VALIDATED
SLC39A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39 (zinc transporter), member 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139143.1-2997s1c1
Sequence:CCGGGCCTGAAGTTATGTGAACATTCTCGAGAATGTTCACATAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139143.1-827s1c1
Sequence:CCGGGCCATCATCAATCAAATTGATCTCGAGATCAATTTGATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139143.1-2072s1c1
Sequence:CCGGCCTGAGATGTTGCACAATGATCTCGAGATCATTGTGCAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139143.1-992s1c1
Sequence:CCGGCCACTCATGAACCGGGTATTTCTCGAGAAATACCCGGTTCATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139143.1-788s1c1
Sequence:CCGGGCTCTGTTGAATGCAACGGAACTCGAGTTCCGTTGCATTCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139143.3-3614s21c1
Sequence:CCGGGCCTGAAGTTATGTGAACATTCTCGAGAATGTTCACATAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1609s21c1
Sequence:CCGGCCACTCATGAACCGGGTATTTCTCGAGAAATACCCGGTTCATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1405s21c1
Sequence:CCGGGCTCTGTTGAATGCAACGGAACTCGAGTTCCGTTGCATTCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-2689s21c1
Sequence:CCGGCCTGAGATGTTGCACAATGATCTCGAGATCATTGTGCAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1444s21c1
Sequence:CCGGGCCATCATCAATCAAATTGATCTCGAGATCAATTTGATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139143
VALIDATED
SLC39A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39 (zinc transporter), member 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139143.1-2997s1c1
Sequence:CCGGGCCTGAAGTTATGTGAACATTCTCGAGAATGTTCACATAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139143.1-827s1c1
Sequence:CCGGGCCATCATCAATCAAATTGATCTCGAGATCAATTTGATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139143.1-2072s1c1
Sequence:CCGGCCTGAGATGTTGCACAATGATCTCGAGATCATTGTGCAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139143.1-992s1c1
Sequence:CCGGCCACTCATGAACCGGGTATTTCTCGAGAAATACCCGGTTCATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139143.1-788s1c1
Sequence:CCGGGCTCTGTTGAATGCAACGGAACTCGAGTTCCGTTGCATTCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139143.3-3614s21c1
Sequence:CCGGGCCTGAAGTTATGTGAACATTCTCGAGAATGTTCACATAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1609s21c1
Sequence:CCGGCCACTCATGAACCGGGTATTTCTCGAGAAATACCCGGTTCATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1405s21c1
Sequence:CCGGGCTCTGTTGAATGCAACGGAACTCGAGTTCCGTTGCATTCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-2689s21c1
Sequence:CCGGCCTGAGATGTTGCACAATGATCTCGAGATCATTGTGCAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1444s21c1
Sequence:CCGGGCCATCATCAATCAAATTGATCTCGAGATCAATTTGATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139143
VALIDATED
SLC39A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39 (zinc transporter), member 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139143.1-2997s1c1
Sequence:CCGGGCCTGAAGTTATGTGAACATTCTCGAGAATGTTCACATAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139143.1-827s1c1
Sequence:CCGGGCCATCATCAATCAAATTGATCTCGAGATCAATTTGATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139143.1-2072s1c1
Sequence:CCGGCCTGAGATGTTGCACAATGATCTCGAGATCATTGTGCAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139143.1-992s1c1
Sequence:CCGGCCACTCATGAACCGGGTATTTCTCGAGAAATACCCGGTTCATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139143.1-788s1c1
Sequence:CCGGGCTCTGTTGAATGCAACGGAACTCGAGTTCCGTTGCATTCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139143.3-3614s21c1
Sequence:CCGGGCCTGAAGTTATGTGAACATTCTCGAGAATGTTCACATAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1609s21c1
Sequence:CCGGCCACTCATGAACCGGGTATTTCTCGAGAAATACCCGGTTCATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1405s21c1
Sequence:CCGGGCTCTGTTGAATGCAACGGAACTCGAGTTCCGTTGCATTCAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-2689s21c1
Sequence:CCGGCCTGAGATGTTGCACAATGATCTCGAGATCATTGTGCAACATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139143.3-1444s21c1
Sequence:CCGGGCCATCATCAATCAAATTGATCTCGAGATCAATTTGATTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012319
VALIDATED
SLC39A6 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39 (zinc transporter), member 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-996s1c1
Sequence:CCGGGCCATCATCAACCAAATTGATCTCGAGATCAATTTGGTTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-497s1c1
Sequence:CCGGCGAGCATCACTCTGACCATAACTCGAGTTATGGTCAGAGTGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-1158s1c1
Sequence:CCGGCCTCTCATGAATCGGGTGTTTCTCGAGAAACACCCGATTCATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012319.2-2030s1c1
Sequence:CCGGGCCTCATGAATTAGGTGACTTCTCGAGAAGTCACCTAATTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-1689s1c1
Sequence:CCGGCCACAGGAAGTCTACAATGAACTCGAGTTCATTGTAGACTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-670s21c1
Sequence:CCGGATCATCACTCTCACCATAATCCTCGAGGATTATGGTGAGAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1138s21c1
Sequence:CCGGATGCAACAGAGTTCAACTATCCTCGAGGATAGTTGAACTCTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1752s21c1
Sequence:CCGGGATCGAACTGAAGGCTATTTACTCGAGTAAATAGCCTTCAGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2768s21c1
Sequence:CCGGTTCACCGGTATTACCAGTTTACTCGAGTAAACTGGTAATACCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2216s21c1
Sequence:CCGGTGACTTTGCTGTTCTACTAAACTCGAGTTTAGTAGAACAGCAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2633s21c1
Sequence:CCGGCTGTACTATGCAGCGTTTAAACTCGAGTTTAAACGCTGCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1963s21c1
Sequence:CCGGATCATGACTACCATCATATTCCTCGAGGAATATGATGGTAGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-435s21c1
Sequence:CCGGGCAATTTCCACACGGCAATATCTCGAGATATTGCCGTGTGGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012319
VALIDATED
SLC39A6 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39 (zinc transporter), member 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-996s1c1
Sequence:CCGGGCCATCATCAACCAAATTGATCTCGAGATCAATTTGGTTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-497s1c1
Sequence:CCGGCGAGCATCACTCTGACCATAACTCGAGTTATGGTCAGAGTGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-1158s1c1
Sequence:CCGGCCTCTCATGAATCGGGTGTTTCTCGAGAAACACCCGATTCATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012319.2-2030s1c1
Sequence:CCGGGCCTCATGAATTAGGTGACTTCTCGAGAAGTCACCTAATTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-1689s1c1
Sequence:CCGGCCACAGGAAGTCTACAATGAACTCGAGTTCATTGTAGACTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-670s21c1
Sequence:CCGGATCATCACTCTCACCATAATCCTCGAGGATTATGGTGAGAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1138s21c1
Sequence:CCGGATGCAACAGAGTTCAACTATCCTCGAGGATAGTTGAACTCTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1752s21c1
Sequence:CCGGGATCGAACTGAAGGCTATTTACTCGAGTAAATAGCCTTCAGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2768s21c1
Sequence:CCGGTTCACCGGTATTACCAGTTTACTCGAGTAAACTGGTAATACCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2216s21c1
Sequence:CCGGTGACTTTGCTGTTCTACTAAACTCGAGTTTAGTAGAACAGCAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2633s21c1
Sequence:CCGGCTGTACTATGCAGCGTTTAAACTCGAGTTTAAACGCTGCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1963s21c1
Sequence:CCGGATCATGACTACCATCATATTCCTCGAGGAATATGATGGTAGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-435s21c1
Sequence:CCGGGCAATTTCCACACGGCAATATCTCGAGATATTGCCGTGTGGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012319
VALIDATED
SLC39A6 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39 (zinc transporter), member 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-996s1c1
Sequence:CCGGGCCATCATCAACCAAATTGATCTCGAGATCAATTTGGTTGATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-497s1c1
Sequence:CCGGCGAGCATCACTCTGACCATAACTCGAGTTATGGTCAGAGTGATGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-1158s1c1
Sequence:CCGGCCTCTCATGAATCGGGTGTTTCTCGAGAAACACCCGATTCATGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012319.2-2030s1c1
Sequence:CCGGGCCTCATGAATTAGGTGACTTCTCGAGAAGTCACCTAATTCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012319.2-1689s1c1
Sequence:CCGGCCACAGGAAGTCTACAATGAACTCGAGTTCATTGTAGACTTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-670s21c1
Sequence:CCGGATCATCACTCTCACCATAATCCTCGAGGATTATGGTGAGAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1138s21c1
Sequence:CCGGATGCAACAGAGTTCAACTATCCTCGAGGATAGTTGAACTCTGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1752s21c1
Sequence:CCGGGATCGAACTGAAGGCTATTTACTCGAGTAAATAGCCTTCAGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2768s21c1
Sequence:CCGGTTCACCGGTATTACCAGTTTACTCGAGTAAACTGGTAATACCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2216s21c1
Sequence:CCGGTGACTTTGCTGTTCTACTAAACTCGAGTTTAGTAGAACAGCAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-2633s21c1
Sequence:CCGGCTGTACTATGCAGCGTTTAAACTCGAGTTTAAACGCTGCATAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-1963s21c1
Sequence:CCGGATCATGACTACCATCATATTCCTCGAGGAATATGATGGTAGTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012319.3-435s21c1
Sequence:CCGGGCAATTTCCACACGGCAATATCTCGAGATATTGCCGTGTGGAAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks