EMAIL THIS PAGE TO A FRIEND

SLC39A7

solute carrier family 39 (zinc transporter), member 7

Synonyms: D6S115E D6S2244E H2-KE4 HKE4 KE4 RING5 ZIP7
UniProtKB ID: Q92504, B0UXF6, Q5STP8, Q9UIQ0
Gene ID:
Human(7922) Summary: The protein encoded by this gene transports zinc from the Golgi and endoplasmic reticulum to the cytoplasm. This transport may be important for activation of tyrosine kinases, some of which could be involved in cancer progression. Therefore, modulation of the encoded protein could be useful as a therapeutic agent against cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(14977) solute carrier family 39 (zinc transporter), member 7
Rat(294281) solute carrier family 39 (zinc transporter), member 7
domestic guinea pig(100732681) solute carrier family 39 (zinc transporter), member 7
naked mole-rat(101725255) solute carrier family 39 (zinc transporter), member 7
cow(540716) solute carrier family 39 (zinc transporter), member 7
sheep(100302555) solute carrier family 39 (zinc transporter), member 7
Zebrafish(30094) solute carrier family 39 (zinc transporter), member 7
dog(481736) solute carrier family 39 (zinc transporter), member 7
domestic cat(101086060) solute carrier family 39 (zinc transporter), member 7
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006979 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077516 Rosetta Predictions human pricing
NM_006979 Rosetta Predictions human pricing
NM_001008885 Rosetta Predictions rat pricing
XM_579273 Rosetta Predictions rat pricing
NM_001077709 Rosetta Predictions mouse pricing
NM_008202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312924 predicted 1171
2 SASI_Hs02_00312925 predicted 1389
3 SASI_Hs02_00312926 predicted 1486
4 SASI_Hs02_00312927 predicted 1371
5 SASI_Hs02_00312928 predicted 540
6 SASI_Hs02_00312929 predicted 356
7 SASI_Hs02_00312930 predicted 807
8 SASI_Hs02_00312931 predicted 614
9 SASI_Hs02_00312932 predicted 1101
10 SASI_Hs02_00312933 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047908 predicted 1465
2 SASI_Hs01_00047910 predicted 1686
3 SASI_Hs01_00047911 predicted 1788
4 SASI_Hs01_00047912 predicted 1672
5 SASI_Hs01_00047913 predicted 844
6 SASI_Hs02_00342711 predicted 662
7 SASI_Hs01_00047914 predicted 1115
8 SASI_Hs01_00047915 predicted 915
9 SASI_Hs01_00047916 predicted 1405
10 SASI_Hs01_00047917 predicted 1633
11 SASI_Hs01_00047909 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071134 predicted 1823
2 SASI_Rn01_00071135 predicted 1566
3 SASI_Rn01_00071136 predicted 1417
4 SASI_Rn02_00199431 predicted 1691
5 SASI_Rn01_00071137 predicted 1362
6 SASI_Rn01_00071138 predicted 1447
7 SASI_Rn01_00071139 predicted 1799
8 SASI_Rn01_00071140 predicted 678
9 SASI_Rn02_00199432 predicted 510
10 SASI_Rn01_00071142 predicted 762
11 SASI_Rn01_00071141 predicted 359
12 SASI_Rn01_00071143 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149816 predicted 1825
2 SASI_Rn01_00149817 predicted 1573
3 SASI_Rn01_00149818 predicted 1422
4 SASI_Rn01_00149819 predicted 1367
5 SASI_Rn01_00149820 predicted 1459
6 SASI_Rn01_00149821 predicted 1799
7 SASI_Rn01_00149822 predicted 684
8 SASI_Rn01_00149823 predicted 350
9 SASI_Rn01_00149824 predicted 770
10 SASI_Rn01_00149825 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292942 predicted 1052
2 SASI_Mm02_00292943 predicted 1425
3 SASI_Mm02_00292944 predicted 1437
4 SASI_Mm02_00292945 predicted 1681
5 SASI_Mm02_00292946 predicted 1434
6 SASI_Mm02_00292947 predicted 416
7 SASI_Mm02_00292948 predicted 1603
8 SASI_Mm02_00292949 predicted 366
9 SASI_Mm02_00292950 predicted 1834
10 SASI_Mm02_00292951 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313349 predicted 1333
2 SASI_Mm01_00183321 predicted 1711
3 SASI_Mm02_00313350 predicted 1726
4 SASI_Mm01_00183323 predicted 1967
5 SASI_Mm01_00183326 predicted 1722
6 SASI_Mm02_00313351 predicted 704
7 SASI_Mm02_00313352 predicted 1886
8 SASI_Mm02_00313353 predicted 643
9 SASI_Mm02_00313354 predicted 2118
10 SASI_Mm02_00313355 predicted 1240
11 SASI_Mm01_00183320 predicted 1804
12 SASI_Mm01_00183322 predicted 1711
13 SASI_Mm01_00183324 predicted 1382
14 SASI_Mm01_00183325 predicted 1777
15 SASI_Mm01_00183327 predicted 431
16 SASI_Mm01_00183328 predicted 640
17 SASI_Mm01_00183329 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008202
VALIDATED
SLC39A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39 (zinc transporter), member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-919s21c1
Sequence:CCGGCTCATCCCAGTAGAATCTAACCTCGAGGTTAGATTCTACTGGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008202.2-774s21c1
Sequence:CCGGACATGCCCATCGTGAACATAGCTCGAGCTATGTTCACGATGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-573s21c1
Sequence:CCGGCGGGCACTCACATGAAGATTTCTCGAGAAATCTTCATGTGAGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-1716s21c1
Sequence:CCGGATTCACTGCAGGCGGATTTATCTCGAGATAAATCCGCCTGCAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-1026s21c1
Sequence:CCGGGCATGCCTTGGAACCTCATTCCTCGAGGAATGAGGTTCCAAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1847s1c1
Sequence:CCGGCCTTAGAGGTATGAGGATCATCTCGAGATGATCCTCATACCTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008202.1-441s1c1
Sequence:CCGGCGGGCACTCACATGAAGATTTCTCGAGAAATCTTCATGTGAGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1026s1c1
Sequence:CCGGGAAATTTGTGAGACACGTGAACTCGAGTTCACGTGTCTCACAAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1590s1c1
Sequence:CCGGGCAGGCGGATTTATCTACGTACTCGAGTACGTAGATAAATCCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1476s1c1
Sequence:CCGGCGTGACTGCAATTGGAGCATTCTCGAGAATGCTCCAATTGCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008202
VALIDATED
SLC39A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39 (zinc transporter), member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-919s21c1
Sequence:CCGGCTCATCCCAGTAGAATCTAACCTCGAGGTTAGATTCTACTGGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008202.2-774s21c1
Sequence:CCGGACATGCCCATCGTGAACATAGCTCGAGCTATGTTCACGATGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-573s21c1
Sequence:CCGGCGGGCACTCACATGAAGATTTCTCGAGAAATCTTCATGTGAGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-1716s21c1
Sequence:CCGGATTCACTGCAGGCGGATTTATCTCGAGATAAATCCGCCTGCAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-1026s21c1
Sequence:CCGGGCATGCCTTGGAACCTCATTCCTCGAGGAATGAGGTTCCAAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1847s1c1
Sequence:CCGGCCTTAGAGGTATGAGGATCATCTCGAGATGATCCTCATACCTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008202.1-441s1c1
Sequence:CCGGCGGGCACTCACATGAAGATTTCTCGAGAAATCTTCATGTGAGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1026s1c1
Sequence:CCGGGAAATTTGTGAGACACGTGAACTCGAGTTCACGTGTCTCACAAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1590s1c1
Sequence:CCGGGCAGGCGGATTTATCTACGTACTCGAGTACGTAGATAAATCCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1476s1c1
Sequence:CCGGCGTGACTGCAATTGGAGCATTCTCGAGAATGCTCCAATTGCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008202
VALIDATED
SLC39A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39 (zinc transporter), member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-919s21c1
Sequence:CCGGCTCATCCCAGTAGAATCTAACCTCGAGGTTAGATTCTACTGGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008202.2-774s21c1
Sequence:CCGGACATGCCCATCGTGAACATAGCTCGAGCTATGTTCACGATGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-573s21c1
Sequence:CCGGCGGGCACTCACATGAAGATTTCTCGAGAAATCTTCATGTGAGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-1716s21c1
Sequence:CCGGATTCACTGCAGGCGGATTTATCTCGAGATAAATCCGCCTGCAGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008202.2-1026s21c1
Sequence:CCGGGCATGCCTTGGAACCTCATTCCTCGAGGAATGAGGTTCCAAGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1847s1c1
Sequence:CCGGCCTTAGAGGTATGAGGATCATCTCGAGATGATCCTCATACCTCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008202.1-441s1c1
Sequence:CCGGCGGGCACTCACATGAAGATTTCTCGAGAAATCTTCATGTGAGTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1026s1c1
Sequence:CCGGGAAATTTGTGAGACACGTGAACTCGAGTTCACGTGTCTCACAAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1590s1c1
Sequence:CCGGGCAGGCGGATTTATCTACGTACTCGAGTACGTAGATAAATCCGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008202.1-1476s1c1
Sequence:CCGGCGTGACTGCAATTGGAGCATTCTCGAGAATGCTCCAATTGCAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006979
VALIDATED
SLC39A7 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 39 (zinc transporter), member 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006979.2-661s21c1
Sequence:CCGGCATGGACATTCACATGAGGATCTCGAGATCCTCATGTGAATGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-1459s21c1
Sequence:CCGGCTAGGGATCCTGACCACAATGCTCGAGCATTGTGGTCAGGATCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-1105s21c1
Sequence:CCGGGCCTTTCTTGTCGTGGAGAAACTCGAGTTTCTCCACGACAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006979.2-627s21c1
Sequence:CCGGGAGCATCTGGCATGGACATACCTCGAGGTATGTCCATGCCAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-2057s21c1
Sequence:CCGGGTTGCATTTGGAAGGCTAAATCTCGAGATTTAGCCTTCCAAATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-1011s1c1
Sequence:CCGGGCCTTTCTTGTCGTGGAGAAACTCGAGTTTCTCCACGACAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006979.1-1124s1c1
Sequence:CCGGAGAGCGTTCTACCAAGGAGAACTCGAGTTCTCCTTGGTAGAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-1595s1c1
Sequence:CCGGGCAGGTGGCTTTATCTACGTACTCGAGTACGTAGATAAAGCCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006979.1-466s1c1
Sequence:CCGGACAGGCACTCACATGAAGATTCTCGAGAATCTTCATGTGAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-567s1c1
Sequence:CCGGCATGGACATTCACATGAGGATCTCGAGATCCTCATGTGAATGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006979
VALIDATED
SLC39A7 MISSION shRNA shRNA Plasmid DNA
solute carrier family 39 (zinc transporter), member 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006979.2-661s21c1
Sequence:CCGGCATGGACATTCACATGAGGATCTCGAGATCCTCATGTGAATGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-1459s21c1
Sequence:CCGGCTAGGGATCCTGACCACAATGCTCGAGCATTGTGGTCAGGATCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-1105s21c1
Sequence:CCGGGCCTTTCTTGTCGTGGAGAAACTCGAGTTTCTCCACGACAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006979.2-627s21c1
Sequence:CCGGGAGCATCTGGCATGGACATACCTCGAGGTATGTCCATGCCAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-2057s21c1
Sequence:CCGGGTTGCATTTGGAAGGCTAAATCTCGAGATTTAGCCTTCCAAATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-1011s1c1
Sequence:CCGGGCCTTTCTTGTCGTGGAGAAACTCGAGTTTCTCCACGACAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006979.1-1124s1c1
Sequence:CCGGAGAGCGTTCTACCAAGGAGAACTCGAGTTCTCCTTGGTAGAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-1595s1c1
Sequence:CCGGGCAGGTGGCTTTATCTACGTACTCGAGTACGTAGATAAAGCCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006979.1-466s1c1
Sequence:CCGGACAGGCACTCACATGAAGATTCTCGAGAATCTTCATGTGAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-567s1c1
Sequence:CCGGCATGGACATTCACATGAGGATCTCGAGATCCTCATGTGAATGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006979
VALIDATED
SLC39A7 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 39 (zinc transporter), member 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006979.2-661s21c1
Sequence:CCGGCATGGACATTCACATGAGGATCTCGAGATCCTCATGTGAATGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-1459s21c1
Sequence:CCGGCTAGGGATCCTGACCACAATGCTCGAGCATTGTGGTCAGGATCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-1105s21c1
Sequence:CCGGGCCTTTCTTGTCGTGGAGAAACTCGAGTTTCTCCACGACAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006979.2-627s21c1
Sequence:CCGGGAGCATCTGGCATGGACATACCTCGAGGTATGTCCATGCCAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006979.2-2057s21c1
Sequence:CCGGGTTGCATTTGGAAGGCTAAATCTCGAGATTTAGCCTTCCAAATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-1011s1c1
Sequence:CCGGGCCTTTCTTGTCGTGGAGAAACTCGAGTTTCTCCACGACAAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006979.1-1124s1c1
Sequence:CCGGAGAGCGTTCTACCAAGGAGAACTCGAGTTCTCCTTGGTAGAACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-1595s1c1
Sequence:CCGGGCAGGTGGCTTTATCTACGTACTCGAGTACGTAGATAAAGCCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006979.1-466s1c1
Sequence:CCGGACAGGCACTCACATGAAGATTCTCGAGAATCTTCATGTGAGTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006979.1-567s1c1
Sequence:CCGGCATGGACATTCACATGAGGATCTCGAGATCCTCATGTGAATGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks