EMAIL THIS PAGE TO A FRIEND

SLC40A1

solute carrier family 40 (iron-regulated transporter), member 1

Synonyms: FPN1 HFE4 IREG1 MST079 MTP1 SLC11A3
UniProtKB ID: Q9NP59, Q6FI62, Q7Z4F8, Q8IVB2, Q9NRL0
Gene ID:
Human(30061) Summary: The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
Mouse(53945) solute carrier family 40 (iron-regulated transporter), member 1
Rat(170840) solute carrier family 40 (iron-regulated transporter), member 1
Zebrafish(58153) solute carrier family 40 (iron-regulated transporter), member 1
chicken(423984) solute carrier family 40 (iron-regulated transporter), member 1
dog(478837) solute carrier family 40 (iron-regulated transporter), member 1
Horse(100069190) solute carrier family 40 (iron-regulated transporter), member 1
domestic cat(101101072) solute carrier family 40 (iron-regulated transporter), member 1
cow(527023) solute carrier family 40 (iron-regulated transporter), member 1
sheep(101113825) solute carrier family 40 (iron-regulated transporter), member 1
naked mole-rat(101705673) solute carrier family 40 (iron-regulated transporter), member 1
domestic guinea pig(100726610) solute carrier family 40 (iron-regulated transporter), member 1
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014585 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014585 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014585 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014585 Rosetta Predictions human pricing
NM_133315 Rosetta Predictions rat pricing
NM_016917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014585 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224698 predicted 970
2 SASI_Hs02_00345861 predicted 1138
3 SASI_Hs01_00224699 predicted 846
4 SASI_Hs01_00224700 predicted 1159
5 SASI_Hs01_00224701 predicted 1483
6 SASI_Hs01_00224702 predicted 592
7 SASI_Hs01_00224703 predicted 715
8 SASI_Hs01_00224705 predicted 1683
9 SASI_Hs01_00224706 predicted 1496
10 SASI_Hs02_00345862 predicted 1661
11 SASI_Hs01_00224704 predicted 1926
12 SASI_Hs01_00224707 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267620 predicted 1888
2 SASI_Rn02_00267621 predicted 1741
3 SASI_Rn02_00267622 predicted 1871
4 SASI_Rn01_00091661 predicted 532
5 SASI_Rn01_00091662 predicted 1580
6 SASI_Rn01_00091668 predicted 1190
7 SASI_Rn01_00091665 predicted 802
8 SASI_Rn01_00091667 predicted 693
9 SASI_Rn02_00267623 predicted 1960
10 SASI_Rn01_00091669 predicted 595
11 SASI_Rn01_00091660 predicted 914
12 SASI_Rn01_00091663 predicted 1114
13 SASI_Rn01_00091664 predicted 1380
14 SASI_Rn01_00091666 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323778 predicted 2106
2 SASI_Mm01_00085581 predicted 1783
3 SASI_Mm01_00085583 predicted 1924
4 SASI_Mm01_00085584 predicted 577
5 SASI_Mm01_00085586 predicted 733
6 SASI_Mm01_00085588 predicted 830
7 SASI_Mm01_00085589 predicted 1821
8 SASI_Mm02_00323779 predicted 1430
9 SASI_Mm02_00323780 predicted 706
10 SASI_Mm01_00085590 predicted 1139
11 SASI_Mm01_00085582 predicted 1055
12 SASI_Mm01_00085585 predicted 547
13 SASI_Mm01_00085587 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014585
SLC40A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 40 (iron-regulated transporter), member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-742s1c1
Sequence:CCGGCCTGTGTGGAATCATCCTGATCTCGAGATCAGGATGATTCCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-714s1c1
Sequence:CCGGCGCTGGTGGTACAGAATGTTTCTCGAGAAACATTCTGTACCACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-1472s1c1
Sequence:CCGGGCATCAGCTATAACTGGAATACTCGAGTATTCCAGTTATAGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-881s1c1
Sequence:CCGGGCAATCACAATCCAAAGGGATCTCGAGATCCCTTTGGATTGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-2031s1c1
Sequence:CCGGGCCACATTATGTATTTCCGATCTCGAGATCGGAAATACATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014585.5-2452s21c1
Sequence:CCGGTTGTTCAAGACTAGCTAATTTCTCGAGAAATTAGCTAGTCTTGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014585.5-882s21c1
Sequence:CCGGACGAAGGATTGACCAGTTAACCTCGAGGTTAACTGGTCAATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014585
SLC40A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 40 (iron-regulated transporter), member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-742s1c1
Sequence:CCGGCCTGTGTGGAATCATCCTGATCTCGAGATCAGGATGATTCCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-714s1c1
Sequence:CCGGCGCTGGTGGTACAGAATGTTTCTCGAGAAACATTCTGTACCACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-1472s1c1
Sequence:CCGGGCATCAGCTATAACTGGAATACTCGAGTATTCCAGTTATAGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-881s1c1
Sequence:CCGGGCAATCACAATCCAAAGGGATCTCGAGATCCCTTTGGATTGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-2031s1c1
Sequence:CCGGGCCACATTATGTATTTCCGATCTCGAGATCGGAAATACATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014585.5-2452s21c1
Sequence:CCGGTTGTTCAAGACTAGCTAATTTCTCGAGAAATTAGCTAGTCTTGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014585.5-882s21c1
Sequence:CCGGACGAAGGATTGACCAGTTAACCTCGAGGTTAACTGGTCAATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014585
SLC40A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 40 (iron-regulated transporter), member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-742s1c1
Sequence:CCGGCCTGTGTGGAATCATCCTGATCTCGAGATCAGGATGATTCCACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-714s1c1
Sequence:CCGGCGCTGGTGGTACAGAATGTTTCTCGAGAAACATTCTGTACCACCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-1472s1c1
Sequence:CCGGGCATCAGCTATAACTGGAATACTCGAGTATTCCAGTTATAGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-881s1c1
Sequence:CCGGGCAATCACAATCCAAAGGGATCTCGAGATCCCTTTGGATTGTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014585.3-2031s1c1
Sequence:CCGGGCCACATTATGTATTTCCGATCTCGAGATCGGAAATACATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014585.5-2452s21c1
Sequence:CCGGTTGTTCAAGACTAGCTAATTTCTCGAGAAATTAGCTAGTCTTGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014585.5-882s21c1
Sequence:CCGGACGAAGGATTGACCAGTTAACCTCGAGGTTAACTGGTCAATCCTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016917
VALIDATED
SLC40A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 40 (iron-regulated transporter), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016917.1-2427s1c1
Sequence:CCGGCCTCCATGTATGAAGGTTATACTCGAGTATAACCTTCATACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-782s1c1
Sequence:CCGGCAGACATGAATGCTACCATTACTCGAGTAATGGTAGCATTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-897s1c1
Sequence:CCGGCGGTTGGAATTTGGTGTCCATCTCGAGATGGACACCAAATTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-1861s1c1
Sequence:CCGGGCAATGGGACATCTTATGTATCTCGAGATACATAAGATGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-672s1c1
Sequence:CCGGCCTGATCATCACTATTGCAAACTCGAGTTTGCAATAGTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-1922s21c1
Sequence:CCGGGCAATGGGACATCTTATGTATCTCGAGATACATAAGATGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016917.2-905s21c1
Sequence:CCGGGTCGGCCAGATTATGACATTTCTCGAGAAATGTCATAATCTGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-2187s21c1
Sequence:CCGGTCGCCAGCAAAGATGGTTATTCTCGAGAATAACCATCTTTGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-1344s21c1
Sequence:CCGGGTGGATCCATCCTTAGTATTTCTCGAGAAATACTAAGGATGGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-843s21c1
Sequence:CCGGCAGACATGAATGCTACCATTACTCGAGTAATGGTAGCATTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016917
VALIDATED
SLC40A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 40 (iron-regulated transporter), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016917.1-2427s1c1
Sequence:CCGGCCTCCATGTATGAAGGTTATACTCGAGTATAACCTTCATACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-782s1c1
Sequence:CCGGCAGACATGAATGCTACCATTACTCGAGTAATGGTAGCATTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-897s1c1
Sequence:CCGGCGGTTGGAATTTGGTGTCCATCTCGAGATGGACACCAAATTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-1861s1c1
Sequence:CCGGGCAATGGGACATCTTATGTATCTCGAGATACATAAGATGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-672s1c1
Sequence:CCGGCCTGATCATCACTATTGCAAACTCGAGTTTGCAATAGTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-1922s21c1
Sequence:CCGGGCAATGGGACATCTTATGTATCTCGAGATACATAAGATGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016917.2-905s21c1
Sequence:CCGGGTCGGCCAGATTATGACATTTCTCGAGAAATGTCATAATCTGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-2187s21c1
Sequence:CCGGTCGCCAGCAAAGATGGTTATTCTCGAGAATAACCATCTTTGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-1344s21c1
Sequence:CCGGGTGGATCCATCCTTAGTATTTCTCGAGAAATACTAAGGATGGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-843s21c1
Sequence:CCGGCAGACATGAATGCTACCATTACTCGAGTAATGGTAGCATTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016917
VALIDATED
SLC40A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 40 (iron-regulated transporter), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016917.1-2427s1c1
Sequence:CCGGCCTCCATGTATGAAGGTTATACTCGAGTATAACCTTCATACATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-782s1c1
Sequence:CCGGCAGACATGAATGCTACCATTACTCGAGTAATGGTAGCATTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-897s1c1
Sequence:CCGGCGGTTGGAATTTGGTGTCCATCTCGAGATGGACACCAAATTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-1861s1c1
Sequence:CCGGGCAATGGGACATCTTATGTATCTCGAGATACATAAGATGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016917.1-672s1c1
Sequence:CCGGCCTGATCATCACTATTGCAAACTCGAGTTTGCAATAGTGATGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-1922s21c1
Sequence:CCGGGCAATGGGACATCTTATGTATCTCGAGATACATAAGATGTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016917.2-905s21c1
Sequence:CCGGGTCGGCCAGATTATGACATTTCTCGAGAAATGTCATAATCTGGCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-2187s21c1
Sequence:CCGGTCGCCAGCAAAGATGGTTATTCTCGAGAATAACCATCTTTGCTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-1344s21c1
Sequence:CCGGGTGGATCCATCCTTAGTATTTCTCGAGAAATACTAAGGATGGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016917.2-843s21c1
Sequence:CCGGCAGACATGAATGCTACCATTACTCGAGTAATGGTAGCATTCATGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks