EMAIL THIS PAGE TO A FRIEND

SLC4A5

solute carrier family 4 (sodium bicarbonate cotransporter), member 5

Synonyms: NBC4
Gene ID:
Human(57835) Summary: This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(232156) solute carrier family 4, sodium bicarbonate cotransporter, member 5
Rat(297386) solute carrier family 4, sodium bicarbonate cotransporter, member 5
Zebrafish(100006379) solute carrier family 4, sodium bicarbonate cotransporter, member 5
chicken(426127) solute carrier family 4, sodium bicarbonate cotransporter, member 5
dog(612275) solute carrier family 4, sodium bicarbonate cotransporter, member 5
domestic cat(101084098) solute carrier family 4, sodium bicarbonate cotransporter, member 5
chicken(425261) solute carrier family 4, sodium bicarbonate cotransporter, member 5
domestic guinea pig(100714846) solute carrier family 4, sodium bicarbonate cotransporter, member 5
naked mole-rat(101705255) solute carrier family 4, sodium bicarbonate cotransporter, member 5
cow(100297538) solute carrier family 4, sodium bicarbonate cotransporter, member 4
sheep(101105902) solute carrier family 4, sodium bicarbonate cotransporter, member 5
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021196 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178581 MISSION® esiRNA esiRNA targeting mouse Slc4a5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021196 Rosetta Predictions human pricing
NM_033323 Rosetta Predictions human pricing
NM_133478 Rosetta Predictions human pricing
NM_133479 Rosetta Predictions human pricing
NM_212512 Rosetta Predictions rat pricing
XM_888058 Rosetta Predictions mouse pricing
XM_913146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075492 predicted 331
2 SASI_Hs01_00075493 predicted 822
3 SASI_Hs01_00075494 predicted 2005
4 SASI_Hs01_00075495 predicted 1990
5 SASI_Hs01_00075496 predicted 550
6 SASI_Hs01_00075497 predicted 2115
7 SASI_Hs01_00075498 predicted 1984
8 SASI_Hs01_00075499 predicted 1979
9 SASI_Hs01_00075500 predicted 621
10 SASI_Hs01_00075501 predicted 1975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154784 predicted 680
2 SASI_Hs01_00154785 predicted 1178
3 SASI_Hs01_00154786 predicted 2360
4 SASI_Hs01_00154787 predicted 2332
5 SASI_Hs01_00154788 predicted 907
6 SASI_Hs01_00154789 predicted 2459
7 SASI_Hs01_00154790 predicted 2334
8 SASI_Hs01_00154791 predicted 2332
9 SASI_Hs01_00154792 predicted 970
10 SASI_Hs01_00154793 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143877 predicted 724
2 SASI_Hs01_00143878 predicted 1224
3 SASI_Hs01_00143879 predicted 2405
4 SASI_Hs01_00143880 predicted 2383
5 SASI_Hs01_00143881 predicted 947
6 SASI_Hs01_00143882 predicted 2504
7 SASI_Hs01_00143883 predicted 2382
8 SASI_Hs01_00143884 predicted 2370
9 SASI_Hs01_00143885 predicted 1013
10 SASI_Hs01_00143886 predicted 2367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217719 predicted 687
2 SASI_Hs01_00217720 predicted 1178
3 SASI_Hs01_00217721 predicted 2358
4 SASI_Hs01_00217722 predicted 2338
5 SASI_Hs01_00217723 predicted 900
6 SASI_Hs01_00217724 predicted 2464
7 SASI_Hs01_00217725 predicted 2340
8 SASI_Hs01_00217726 predicted 2332
9 SASI_Hs01_00217727 predicted 965
10 SASI_Hs01_00217728 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120286 predicted 1658
2 SASI_Rn02_00270514 predicted 920
3 SASI_Rn02_00270515 predicted 2032
4 SASI_Rn01_00120288 predicted 3129
5 SASI_Rn01_00120289 predicted 3146
6 SASI_Rn01_00120290 predicted 2227
7 SASI_Rn01_00120291 predicted 646
8 SASI_Rn01_00120292 predicted 1702
9 SASI_Rn02_00270516 predicted 1250
10 SASI_Rn01_00120293 predicted 2327
11 SASI_Rn01_00120285 predicted 2058
12 SASI_Rn01_00120287 predicted 1115
13 SASI_Rn01_00120294 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205532 predicted 1937
2 SASI_Mm01_00205533 predicted 1560
3 SASI_Mm01_00205535 predicted 1613
4 SASI_Mm01_00205536 predicted 2767
5 SASI_Mm01_00205537 predicted 2225
6 SASI_Mm01_00205538 predicted 946
7 SASI_Mm02_00428594 predicted 1049
8 SASI_Mm02_00428595 predicted 814
9 SASI_Mm01_00205539 predicted 2758
10 SASI_Mm01_00205540 predicted 845
11 SASI_Mm01_00205534 predicted 249
12 SASI_Mm01_00205541 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437511 predicted 1931
2 SASI_Mm02_00437512 predicted 1565
3 SASI_Mm02_00437513 predicted 1606
4 SASI_Mm02_00437514 predicted 2761
5 SASI_Mm02_00437515 predicted 2228
6 SASI_Mm02_00437516 predicted 948
7 SASI_Mm02_00437517 predicted 1051
8 SASI_Mm02_00437518 predicted 818
9 SASI_Mm02_00437519 predicted 2752
10 SASI_Mm02_00437520 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021196
SLC4A5 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 4 (sodium bicarbonate cotransporter), member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1873s1c1
Sequence:CCGGGCCAGCTTTATCATCAAATATCTCGAGATATTTGATGATAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1641s1c1
Sequence:CCGGCGACAATTATCAGGGAGTGATCTCGAGATCACTCCCTGATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-2574s1c1
Sequence:CCGGCCGGAAGGAGAACAAACTGAACTCGAGTTCAGTTTGTTCTCCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1989s1c1
Sequence:CCGGCCCTATCAATATGGACTTCAACTCGAGTTGAAGTCCATATTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-335s1c1
Sequence:CCGGCCCTCTTTACAGAGATGGATACTCGAGTATCCATCTCTGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021196.3-676s21c1
Sequence:CCGGACCGCTCCTTAGCTGACATTGCTCGAGCAATGTCAGCTAAGGAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021196.3-1161s21c1
Sequence:CCGGATCGCAGGAATTGATGAATTTCTCGAGAAATTCATCAATTCCTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021196
SLC4A5 MISSION shRNA shRNA Plasmid DNA
solute carrier family 4 (sodium bicarbonate cotransporter), member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1873s1c1
Sequence:CCGGGCCAGCTTTATCATCAAATATCTCGAGATATTTGATGATAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1641s1c1
Sequence:CCGGCGACAATTATCAGGGAGTGATCTCGAGATCACTCCCTGATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-2574s1c1
Sequence:CCGGCCGGAAGGAGAACAAACTGAACTCGAGTTCAGTTTGTTCTCCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1989s1c1
Sequence:CCGGCCCTATCAATATGGACTTCAACTCGAGTTGAAGTCCATATTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-335s1c1
Sequence:CCGGCCCTCTTTACAGAGATGGATACTCGAGTATCCATCTCTGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021196.3-676s21c1
Sequence:CCGGACCGCTCCTTAGCTGACATTGCTCGAGCAATGTCAGCTAAGGAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021196.3-1161s21c1
Sequence:CCGGATCGCAGGAATTGATGAATTTCTCGAGAAATTCATCAATTCCTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021196
SLC4A5 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 4 (sodium bicarbonate cotransporter), member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1873s1c1
Sequence:CCGGGCCAGCTTTATCATCAAATATCTCGAGATATTTGATGATAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1641s1c1
Sequence:CCGGCGACAATTATCAGGGAGTGATCTCGAGATCACTCCCTGATAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-2574s1c1
Sequence:CCGGCCGGAAGGAGAACAAACTGAACTCGAGTTCAGTTTGTTCTCCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-1989s1c1
Sequence:CCGGCCCTATCAATATGGACTTCAACTCGAGTTGAAGTCCATATTGATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021196.2-335s1c1
Sequence:CCGGCCCTCTTTACAGAGATGGATACTCGAGTATCCATCTCTGTAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021196.3-676s21c1
Sequence:CCGGACCGCTCCTTAGCTGACATTGCTCGAGCAATGTCAGCTAAGGAGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021196.3-1161s21c1
Sequence:CCGGATCGCAGGAATTGATGAATTTCTCGAGAAATTCATCAATTCCTGCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks