EMAIL THIS PAGE TO A FRIEND

SLC52A1

solute carrier family 52 (riboflavin transporter), member 1

Synonyms: GPCR42 GPR172B PAR2 RBFVD RFT1 RFVT1 hRFT1
Species: Human SLC52A1(55065), domestic cat SLC52A1(101080428)
UniProtKB ID: Q9NWF4, B5MEV1, B5MEV2, Q6P9E0, Q86UT0
Gene ID:
Human(55065) Summary: Biological redox reactions require electron donors and acceptor. Vitamin B2 is the source for the flavin in flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) which are common redox reagents. This gene encodes a member of the riboflavin (vitamin B2) transporter family. Haploinsufficiency of this protein can cause maternal riboflavin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
domestic cat(101080428) solute carrier family 52, riboflavin transporter, member 1
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017986 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080451 MISSION® esiRNA esiRNA human GPR172B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104577 Rosetta Predictions human pricing
NM_017986 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323744 predicted 1996
2 SASI_Hs02_00323745 predicted 869
3 SASI_Hs02_00323746 predicted 1632
4 SASI_Hs02_00323747 predicted 1402
5 SASI_Hs02_00323748 predicted 1366
6 SASI_Hs02_00323749 predicted 1079
7 SASI_Hs02_00323750 predicted 1597
8 SASI_Hs02_00323751 predicted 1069
9 SASI_Hs02_00323752 predicted 1130
10 SASI_Hs02_00323753 predicted 1997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203391 predicted 1963
2 SASI_Hs01_00203392 predicted 828
3 SASI_Hs01_00203393 predicted 1597
4 SASI_Hs01_00203394 predicted 1361
5 SASI_Hs01_00203396 predicted 1325
6 SASI_Hs01_00203398 predicted 1044
7 SASI_Hs01_00203399 predicted 1560
8 SASI_Hs02_00351026 predicted 1036
9 SASI_Hs02_00351027 predicted 1096
10 SASI_Hs01_00203395 predicted 1964
11 SASI_Hs01_00203397 predicted 1414
12 SASI_Hs01_00203400 predicted 1895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017986
SLC52A1 MISSION shRNA Bacterial Glycerol Stock
solute carrier family 52 (riboflavin transporter), member 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-928s21c1
Sequence:CCGGGGTACAGGTGCTGAGTGTAGTCTCGAGACTACACTCAGCACCTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017986.3-2153s21c1
Sequence:CCGGCCACAGAAGACGTTGGCATGTCTCGAGACATGCCAACGTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1010s21c1
Sequence:CCGGTCTGTGGCCTTCCTAACTCTGCTCGAGCAGAGTTAGGAAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1100s21c1
Sequence:CCGGCCTCCTTTCTTACGGTCTTTCCTCGAGGAAAGACCGTAAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1832s21c1
Sequence:CCGGTGTCTGTGTGTGTTCTCATATCTCGAGATATGAGAACACACACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1333s21c1
Sequence:CCGGGCCATCACTACCCTCTGTAACCTCGAGGTTACAGAGGGTAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017986.3-2080s21c1
Sequence:CCGGCCACAGTGCCTGACTACTTGTCTCGAGACAAGTAGTCAGGCACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1968s21c1
Sequence:CCGGCCAGCATCTACCACGTGTTTCCTCGAGGAAACACGTGGTAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1046s21c1
Sequence:CCGGATGGCCTGTTGTACCTCTAATCTCGAGATTAGAGGTACAACAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017986.2-2134s1c1
Sequence:CCGGACACCTGCACACTCCACAGAACTCGAGTTCTGTGGAGTGTGCAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1972s1c1
Sequence:CCGGCCACGTGTTTCAAAGCAGAAACTCGAGTTTCTGCTTTGAAACACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-815s1c1
Sequence:CCGGCCCTCATACCTCTCTGTGGTTCTCGAGAACCACAGAGAGGTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1326s1c1
Sequence:CCGGTGCCATCACTACCCTCTGTAACTCGAGTTACAGAGGGTAGTGATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1093s1c1
Sequence:CCGGACCTCCTTTCTTACGGTCTTTCTCGAGAAAGACCGTAAGAAAGGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017986
SLC52A1 MISSION shRNA shRNA Plasmid DNA
solute carrier family 52 (riboflavin transporter), member 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-928s21c1
Sequence:CCGGGGTACAGGTGCTGAGTGTAGTCTCGAGACTACACTCAGCACCTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017986.3-2153s21c1
Sequence:CCGGCCACAGAAGACGTTGGCATGTCTCGAGACATGCCAACGTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1010s21c1
Sequence:CCGGTCTGTGGCCTTCCTAACTCTGCTCGAGCAGAGTTAGGAAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1100s21c1
Sequence:CCGGCCTCCTTTCTTACGGTCTTTCCTCGAGGAAAGACCGTAAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1832s21c1
Sequence:CCGGTGTCTGTGTGTGTTCTCATATCTCGAGATATGAGAACACACACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1333s21c1
Sequence:CCGGGCCATCACTACCCTCTGTAACCTCGAGGTTACAGAGGGTAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017986.3-2080s21c1
Sequence:CCGGCCACAGTGCCTGACTACTTGTCTCGAGACAAGTAGTCAGGCACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1968s21c1
Sequence:CCGGCCAGCATCTACCACGTGTTTCCTCGAGGAAACACGTGGTAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1046s21c1
Sequence:CCGGATGGCCTGTTGTACCTCTAATCTCGAGATTAGAGGTACAACAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017986.2-2134s1c1
Sequence:CCGGACACCTGCACACTCCACAGAACTCGAGTTCTGTGGAGTGTGCAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1972s1c1
Sequence:CCGGCCACGTGTTTCAAAGCAGAAACTCGAGTTTCTGCTTTGAAACACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-815s1c1
Sequence:CCGGCCCTCATACCTCTCTGTGGTTCTCGAGAACCACAGAGAGGTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1326s1c1
Sequence:CCGGTGCCATCACTACCCTCTGTAACTCGAGTTACAGAGGGTAGTGATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1093s1c1
Sequence:CCGGACCTCCTTTCTTACGGTCTTTCTCGAGAAAGACCGTAAGAAAGGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017986
SLC52A1 MISSION shRNA Lentiviral Transduction Particles
solute carrier family 52 (riboflavin transporter), member 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-928s21c1
Sequence:CCGGGGTACAGGTGCTGAGTGTAGTCTCGAGACTACACTCAGCACCTGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017986.3-2153s21c1
Sequence:CCGGCCACAGAAGACGTTGGCATGTCTCGAGACATGCCAACGTCTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1010s21c1
Sequence:CCGGTCTGTGGCCTTCCTAACTCTGCTCGAGCAGAGTTAGGAAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1100s21c1
Sequence:CCGGCCTCCTTTCTTACGGTCTTTCCTCGAGGAAAGACCGTAAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1832s21c1
Sequence:CCGGTGTCTGTGTGTGTTCTCATATCTCGAGATATGAGAACACACACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1333s21c1
Sequence:CCGGGCCATCACTACCCTCTGTAACCTCGAGGTTACAGAGGGTAGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017986.3-2080s21c1
Sequence:CCGGCCACAGTGCCTGACTACTTGTCTCGAGACAAGTAGTCAGGCACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1968s21c1
Sequence:CCGGCCAGCATCTACCACGTGTTTCCTCGAGGAAACACGTGGTAGATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017986.3-1046s21c1
Sequence:CCGGATGGCCTGTTGTACCTCTAATCTCGAGATTAGAGGTACAACAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017986.2-2134s1c1
Sequence:CCGGACACCTGCACACTCCACAGAACTCGAGTTCTGTGGAGTGTGCAGGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1972s1c1
Sequence:CCGGCCACGTGTTTCAAAGCAGAAACTCGAGTTTCTGCTTTGAAACACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-815s1c1
Sequence:CCGGCCCTCATACCTCTCTGTGGTTCTCGAGAACCACAGAGAGGTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1326s1c1
Sequence:CCGGTGCCATCACTACCCTCTGTAACTCGAGTTACAGAGGGTAGTGATGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017986.2-1093s1c1
Sequence:CCGGACCTCCTTTCTTACGGTCTTTCTCGAGAAAGACCGTAAGAAAGGAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks